Description :
From Genome Similarity Track
Location :
Scaffold_1333:303- 1919
Transcript NameFunction/comments
Physo_145478CG6206 CG6206-PB, isoform B

Sequence
1616 bases(100 bases per row)
TGCACGAGCAGAATGTGAGTGAGGACGTGGATGACGAGGTGGTTGTGCTGGAGAACCACCACCTCCGAGCTGAGATCAGCAAGAAAACAGGCTCCATTAC
CAAGCTTGCAAACAAGAAGAAGAACATCCAGATCCCGCTGTCGCTGGATGTGGCGTACTACCAAGCGTTCCAAGGTGACGGACCCAAGTCTGGTGCGTAC
ATTTTCCGTCCTGACTCGAACAAGACATACCCGGTCACTGATGGTGCTTCCAACGGCGCCGCGTCGGCCCCTTTGCCTGATGTTACAATGGTGGAGCTGC
AAACCACCAGCCGCAGTAATGCTATGAGTGTGCCCCGCGTGGCGTTCAAGATCGGCAGCTGGGTCACACTTGAGTATCGGGTCAATGACGACGACAAGTT
CCTCGAGATCGAGTGGACCGTCGGTTCAGTCCCAATTGACGACAAGAAGGGCAAGGAGGTCATCATGCGCTTTGACGCTGGCGAGAGTATCGCGTCCGAC
GGCACGCTGTACACGGACTCGAACGGACTGGAGTTTGTGAAGCGCGTGCGCAACCACCGTGACACGTGGAATCTGACGTTGCACGACGACCAGGAGGGTG
TGTCGGCCAACTATTTCCCCATTACGACTGGCGCCTACATTAAGGACTCGAAGCGCCAGCTGAATCTAGTGACAGACCGTGCGCAGGGAGCGGCGAGTCT
GGTGGATGGCCAAGTGGAGGTAATGGTGCACCGACGTCTACTCGCGGATGATGGCAAGGGTGTTGGAGAGCACTTGAACGAGACGGAGTCCGTGCTCGAC
TCCAACGCGAAGAAGCACGTAACCAAGGGTCTGGTGGTGCGCGGCAACTTCTTCATTAACGTCGACTCGGCCGATGATGGCATGCGCAGCCTGCGATCAA
AGATGGAGTCGCAGTTCTTCCGTCCGCTCACGGCCTACCGCAAGCCGGTAACCAGCGACGTGAAGGCGAAGGTGCCGTGGCTGACCGTCGGCGAGTTCCC
TCCGAGCGTGGGTCTGACGACGGTACAGGAGCTGTCGAAGCAGTGTCTGATGGTGCGTCTGTCGCACCTCTACGCCGTGGAGGAGCACGCGACGCTGTCA
CAACCAGCGACGGTGGACTACTCGACGTTATTCACTGTGAAGAACTCGGTGGTGTCGGAGGTGACGGAGCTGGTGCTGACTGGCACGAAGGAGCTGGGCG
CAGAGGACAACCGCGTTGGTCTGGAGTGGAAGACGACGGACGATGCGTACGGCTGGTCCCCGCAGTCGCTCCCTGTGAAGGGCACGACGGTGACGCTGCA
GGCGATGGAGGTGCGCGCGTTCCGCGTGTGCTTCTCGAAGGGCGATGTTACTGCTGTGGAGGCGGAGGAGTCTGGTGAAAAGAACAAGGCTGAGGATGTG
GAGGACATCGATAACTGGGAGCAGGAGGAGGGCTATTCGTTCGGTGCTGCGCTGCAGGACCTGGCGCAGATGATCGCGGTTGAGTGATAAGTGTGTCCAG
GTGATCTCGTCGATTTAGCGGCACTAAGCACAAGGAGGTCTGTTGATCTATTGTATCTGTTGATCTATGTATCCGAAGTACACANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNN