Description :
From Genome Similarity Track
Location :
Scaffold_33:302906- 305030
Transcript NameFunction/comments
Phyci_147559Hypothetical protein
Phyci_6414Hypothetical protein

Sequence
2124 bases(100 bases per row)
cgcagtgatccattatccagacttcaaaaccataaacgcgttcccatccaagggtgactttcaccttcgctcggcgagtcgtcatcatctttcccttggt
gatcccttgtacatccatgcaacgtccatgccccactacttcgcggagtttcagtcgcttggcaagtttctccgagatgacactgacatttgccacagtg
ttcagcaatatcctcgtgcgcgagtcgcccacggttccgttcaccagtgtccgcatccttacgcgcttgtcacgtccagcgagaactcgacgctgcagtt
ggggcatttctgcgccgaccaccatcccatccgttctccagctaagcgtcgcacttctggaacgagtcgtcggcgcgagtcttcttgtattgcgcttgtc
agccagtcttcggcggtatctcccacctcttccttatcgtcttctttatacaatacacctccaccgaggcaatcgcctctctccttttccaattccgtcg
ttttcatgtcgttgtcttgctcagtcttcgtccattcgcactcgcccacaaatgcaaagatgcactcggcttcaattgcgggctcggctaactgtggcag
cccgattgggaccaacccagtcgtagttggcgggctgcctagtttaaatggtccgaaaacagtagttcttggagctcgggtgtgaggtctttcttgtcca
ccttggacttgatgatcttggtgatttcttggaacacttcacattttccggcgtcgtgcacttggttgaacagcttgcaccgatgtcggcagcagtgcgc
cgagtgatagaggcccccgcaggctgcgcacggcccatactggcgaggtttctcggcgcggtaaccgcggttctggaaccgattgtcccggccttggctg
tgccccgctgagtcaccccagggttgtcggttggcggaccgggcggacgtaccttcagcggcaactcgtcgttcgttgtcattggctgccgcaaggtagt
ggtcgcatccgtctgacgaatagctatcaccccggtcttcgccgcaacgttgtgagtcgtcgctgccgtgttcacttccatcttcgctgttgctgtcacc
atcatatctgtggcgttgttgctgtagctcgctccgcgtatcccgcgtgtcccgtccatgaagttcggcgacaatgtcagcgacagatgcttcggctagg
ctcacgcgaagcatattgcgtgagtcatcgcgacgacgctcataatctcgttcgcgacggtcgcgacggttgtaagcatctcgcgagtcgtcgcggcggc
ggtcatcacgtcggtgagtgtcttccgagcgctcgtggcggcgcgaatcatctcgacgtctgtcatcacgtcgtcgggaggcatcccgagctcgagagtg
aggcagcgacgactcgcggggcgaattgcgcacgtcaattttcagtatcgcttggatcatctctttcaactcatgtaaatctgagatgcgcaggtggcac
aggccccgttcgagtcctcggtcaccacaagtctcgcggaaccgcttgacgtggtcgcgtgctttgcggccgttgctctcacaccgaattccggcgttcc
tggcatagccattgagccggtttaggtagtcgcaaacatgttccttgtcttcgcacttggctgagtagtagcaagtccccgctgactggttgaactggga
gcaatagtatttgatgaaggcctcacttaggaggctccatgttcgcttggtcttcttgggcagttgtcggtaccaatgcagagcgccgtcccgaagcctc
agctcgaacggcatgcaccattccttgggcgatgctcgcgttcctttcatctcgtagacaaaggcgcgaagccattgcatcgagttctcgctcttgttcc
tggtgcccgagaacgccttgatctgccccagtgggcgatgcgttgtcacctcaatcctcggagtcgcgttaagcaactcgaagtcggtcacttcacggat
ttggcgcaggtacccgcccatctgcgctcctccatcgccggtaaagtccgcttcttcatccgacgagtcgtcggtgggcccgctgcggcggatcctgctc
cgtcctgaactgcttttcgtgccc