Description :
From Genome Similarity Track
Location :
Scaffold_350:3029- 8143
Transcript NameFunction/comments
g5986.t1OWY90473.1 hypothetical protein PHMEG_00041381 [Phytophthora megakarya

Sequence
5114 bases(100 bases per row)
CGGTGTACGTGTTCTCTGACGATCGTTGTGGTTGGCGTGTTTGACACGAAGTATTCCTGGTTTTTCTGTGACGCCCGCCATCGCGACGCTGGTCTAAAAT
TTCGAGCATGGATACTATTGGATGAAATGGAAAATGTGACTCAGCTGTACCCGTGCGACACGGGTGACGTATGAAGTGCGACTGATTTATGGAAAGATCT
TACGCCTAACCACAGATGGGCCCAACTGGCTGGAAGTGTGTATCCTGGATGTGTACAAATCCACGGTTATAAACCCGCATTATGTCCAGCCCCCGGACTT
TCCCTTACGATGAGTGCCTAAAAGCCTGGCGGAAAGTGCAGTTGAGAACGTATCTCAGACTGTATCTCATCTTGCTGTGGTTCAGAGCGACTACTAACGA
TACTGAACCAAGATCATCCACTACCAACACCCAAGTCGTGCGCTGGAAGCCCAAAGAGTCTGGATGTCAAGTACATCCTGAATCCTGACTCCAGAATACC
AGAATCATGACGGTTGACCACTGACTACTGACTTCGAAGACAGTGGTACGTCATGAAGTGAAACGCAATTGAACTACCACCAAAGAACCCAACAGAACTG
TCGAGTCGACACTTTTGAAGCTACGAAGACAATGTACCCAGACCATACTGAAGCGAAGACAATTTGACCCAAGCTATAGTGAAATCAAGATAAATCACCC
AGAGCCGAGATCTAGAAAGAATTGATAGCTTAAGGCTTACAGCCAACAACAGAGTTTGTTTTACCCCGTACTGCGCAAGTGAATTCGGCCAAGCCTGCCG
ACGGAAATCCGGAGGACCCGAGACTACGACCGTGATACAACAAGGGGCGCTGCGACCATTAAGGACGGGTCGTCTGTGGCATCTCCACCTCATTACATCA
AGTCCAGTTAGGTGGTGACCAGAGGCGCTCCGGCACCCTGGGTTGACCCACCTATTTCATATCCTAGTTGGGTCGCTAGCGTGCTGGTGTTTGCCCATTT
CATATTCCCTTGCTATTCGAGGTGACTGACTAGCAGTTGTCCCCCGAAGTGATAGTTTAACTGCTGTGTGTATCGACTGACTATAGTATTTGATAGTTTC
TCTCTTAATTGAGAGTGGTGCGCGTTTTATACGAGTGTTCATACTGACTAGGTGTCTGAATTGTAAGACTCGAGTGAGCCTAGCGAGTGACCCACCGTCC
AAGGGTCGAAAAGAATAAGTGACGGCTATTTGTATTGTATAGAACTCTGTATTTGTTGGCTATTGGTATTTGGGGTGCATCCTGGGTAAAGGTGCATCCT
GGATTTCCGATACTCTGGGTGTGAAATCCAGACTACACTCTGGCTTTCTGTCGTTGAGGGTGCATCCTGAAGTGGACGTAAGCTCGGCACAACTTCAAGG
CCACAAGCTCGGTGAAGTGCCGTTTCGTCAAAGACAAACGAGCCGACAGGGATTCCGCAAGGTACCCACGCCACCAAGAACCCAAGGTTTTGCTTCGCGG
TGAGATCTTGGATACTTGTTGACTCCTACAAGTCTTCCCCCTTCATTCCTGGAGGAGGAATTCCTGGAGCGCGCTATACGAACCCCCCTGGGCGGTAAAG
GTTTCATCGACCTCGCCACATGTTCACTTGAACAGACGAGATATTGGTATCAAGAAGACGTTTTTTTTTCTTTTTCTATCTCCACAACGTTCCCCCCGAT
CTATGCGCATTCTTTTGAAAGACTATAAAACGCCAGTTGCTGTGCAGCACGACGTTTTCAAGAATTTTTGCAGCTAATAGAAAATTCCACGGAGGCAACT
CCAGAGTTTTCTATCAGAACGGGATGGTATCAACATTGATGCTTTACGTCTTCTATACAGAGCCAAAGATGCAGTCTTAGAAAGCTTTGATGTCGAATGG
GCACAGTCATTTACGCTGATACCTGCTGAAATTGTTTGACGCTAAAAAGACTAGAACTCGCGTTGCGTTCGATCTAGATTCAGATGGTCCATTTTTTCGT
GCGTTCGTAGCTTTGGGAGCTGCTATTGATTGTTTTGAGGCATGCCTTCCTATGTACGGCTTTGATGGAACTCACTCAAAGAACAACATGTACCGCATCA
TCAGAATAACGTTACTGGGTCGAGATGGCAACGGTAATAATCTTACAATTGCTTTTGCAGTCGTAAACTCAGAAAATGAAGATAACATACAGTGGTTTTT
CGAAAACTGAGCACACTCTGGAGTTGTATTCGACAAAATTCCTCTCTTTTGCGATCGAGGTCACATTGTCGGCGCATCGCAAAAGCTGGCGGTGAATGAA
ATTCGTCTGAACCTTAAATTTGATCAATCCACACCATCCGCAACGTGCATATAGAATTCAAGCATCACGGAAAAGCTGTAGAGAATGCAATATTACGTGT
GCACGGTGCTTCTACAAAAGCAAAATATGAAGCAGCTTTAGACACGCTTGAAGGTTCCTTCAGGATAATACTCGCGATTACACAGTCCTAAGGCAACTCA
ACTCCGCCTGGAAGCGTGTAAAGACGCGGGGCCGTATAATGTCGAGGGAAGTGCCCCAGGTATATATACTACAACTCGCAAGGGGTTTGGATCGAGGCGT
GAGGTTGATGTGGAGTGTTTGTCTTGCTCGTGCAAGGCGTTCGTTCACGTAAAAGTCCCATGTCGCCACCTTACCGCTTCTCTTCGTAAGGCCGAGCATC
CTCAAAGAGAAGATGAGATCTTCTTCACCGCGTATAAAGTGAGTACGTACAAGTCATCTTTAGGTATCATGAGCGTCAGGATGGTTGACGATGACGATGT
CATCAAAGATCACACGATTCTCCCATCGCCTTTATATCGGCAAGCAGGGTGGCTGAAAACTAGGCGGCTTGCAAGCGGCGGTGGGGCAAACAGTGGCAAG
ACTTACAAGTGCCGAAGATGCAACAGGCATCAGAGACATAATATTGCAACTTGCCCCCACTATTCACTAGGCGTACGAAATTACGGCATTCGTGTTGGTC
GAACCGTTCTTACGGCCCACCAAATAGAAGGCGAAGACACGGATTCTCCAATGCCACTAGATCAAACAGAAGGGCAGCGTTCCTTGGGTCCGATCAGGGA
TGGACAGTGTAGCGGGGCTACACAGTCAGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTTGACCACTCCACAGGGTGGTCCAC
ATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAAC
CTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATATAGTTCTCATTTGGCACCAAAGCTATCGTTCGGTCCCTTTATCTAGGTTT
CAGTATACTTGCGGATACAAGTATACTGAACTTAAGTTAAATACACCTACGCTTGCTCATACATGTGCGCACAAGTGCAAGCTTAAGTAGTGGACCCATT
ACACCTGGTAGCACATTGTAATCTGTCCAACGACCGACTAAAAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACAT
GTCCGTGGGTAGCCCAACCACGTCTGCAACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGTCCTCCAACGACTGTCAACA
GTCATAGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGCAA
CCGCTGCTCGAGCTTCGGTGTCGCCATCGGCCACACCGCGCATGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGGGAACCTCTCCT
CCGTTGGCTAGTCGAGGTCGACACTGCCATTACGGCTCGACGTATCGTCGATCCGTTGTCGAAGGTTGCGTTCGCCATATCATGTCTTGGCGGACGAGCG
AGGAGTTAGGCGTACGGACGCCGACTCACAGACCCTACGTGCTTTAGCACGTACGAGGATTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAGA
ACGAGTTCCGATTGAGGGCGGAGTTCCTCGATCTGCAACAGGGAAAGAATGACGTGCATGCTTACGCTCAAAGAGCACGGTACTTGGTCTCGAACATCGT
GACCAACCCGATCGAAGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGTGTGGTGTAGAGAAACTCATATTTGGGTAGGCCACCCAG
TCTGGCCCAGTTAGGTACGTCGTACCTAACCGAAGTTTGCACTTAAGCGACGAACTCAGTGATTGATCGGAGTCAGCGAGCAGCACGACTCAGCGAGCAG
CGGAACTCGACGAGCGTATTCCATGTGAGAGTTATTCCAAGTGGGAGAGGATAAATCAGGAATCGGAGCGAAGGGTCGGCCGAGATCCATAACGACTCGA
CTCGGCGAAGATCAACTAGGAAGCTGAGCGAAGGGTCGCAGGGAGATCTATAACGACTCCATTTCACTAGGTATTTGTATAGGATCGATAGGAGACCAAA
AGGGGGAGCCCGAAGGGACTCCCCGAAGACACAGAGATAACAAAACAGAGCAGAATCTTCTAAGTCCAAGAACAACGTATACTTTCCGGTAAGTCCCTGC
GTGGGCTCGATTATGTCTGCCGTCGTTCCCCGAGAGGCATAGCTTGTAGAGGAATCGACTGGTAGCGCCAAAAGATCAAGGTCGGCCCGGGGTGGGCACT
TCTCGCTACCAACGAAGACAAACCTCGTCAAATCGACGAGTCGGTGGGTCTGCACAACCCAGGACACCGCAATCTTCTAGCTGAGCGTACTCTGCGCTCG
GTGACCTGTAAAAGCGCTCGCGCGCCGACGTCCATCCTTTGGTGGAGGTCACAGGGTTGGAGGAACGGAAGCTGCCCCGCTCAGGCGATCTTCTGGGGTT
TGGATTGGTACTCAGCGAGAGCAGAGCCTCAACTGGACCCGGTTGGGCCGAACCGCAAAGGGAACCAACAGAATCCTGCGCAAGCCCAACAGCGCCGACT
TGACTCGGCGAATT