Description :
From Genome Similarity Track
Location :
Scaffold_127:30284- 31320
Transcript NameFunction/comments
Physo_109528polyprotein

Sequence
1036 bases(100 bases per row)
AGCTCATCAACAAGATGAAGAAGATGTTCGAGGACCGGTTTGCGATGAAGGATCTCGGGGCGTTACACTACATTCTAGGCTGGGAGATCACGCGGAACCG
GGCCGAGAGAACGATGTTCATTGGTCAGCAGAAGTATGCCGAGACCGATCCTCAAGCGGTTCAACATGCAGGACTGCAATGGCTGCAAGACGCCGAGCAC
GGCGGATCTGAAGCTGAGCAAGGCCATGTGTCCGACCGAAAACGATGAAAGGCAACTGATGAGATCGACGCCATATCGTGCTGTGGTTGGCAGCCTGATG
TACCTGATGCTCGGTACCCGACCCGATCTGGCCTACCTAGTTAGAGAGTGCAGTCAGTTCTTGGAAAACCCAGGTCTGTTGCATTGGAGAGCTGCAAAAC
GTGGATTGCGCTACCTGAAAGACACAGCGGACTGGGGGGTCCAGCTTGGTGGCCTAGCGTGGTCAGATCAAAAGCTGGATGATCATCTGAGAGCATACGC
AGATGCGGATTTTGCAAATCGAGTTGATGATCGAAAGTCTGTTGCAGGCTACGTGACTCAATTTTGTGGGAGCATCATTTCGTGGAGCAGCCAGACGGAG
AAGACCGTCGCGCTGCACACGACCGAGGCCGAATATATGGCTCTTAGTCTACTGGTGCAGGAGGTGGTGCACTTGCGCCAAATGCTGAAGGAGCTGCAGG
TGCAGCAAATTCAGCCATCCCAAGTCTTTGTTGACAACGAAAGTTCAAAGAAGCTTGCCAGCAACCCTGTGTTTCATTCTCGGACCAAGCACATCGATGT
GCGCCACCACTTCGTGCGTGAGCGCATCGATTTGAAGGAAATTGACGTGCTTCGGGTGCCAGGAGTTGATAACATGGCCGATGCTTTTACAAAGCCATTG
GCACGTCCGGCATTTGAAAAACACAGAGCTGCAATGGGATTATTGCCAAGGGCAAGATTTGGAGATGCAAGTTGATGGGAATCCGTAGGTGGGGCTGTTG
CGGATTATACTGATCTCCACTATACTACTTGCAGTT