Description :
From Genome Similarity Track
Location :
Scaffold_334:3028- 6650
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_334-snap-gene-0.222-oxoglutarate dehydrogenase E1 component

Sequence
3622 bases(100 bases per row)
CCTACATGCATTTTGTACTACTGCTACTTATGATTATTGTCGTGGCGCCCCGAACGCCTTGGCAAAGATCTCCTGCGTTTGTTCCTTGTTGCGCTTCGAG
AGACCGACGGCCGAGGCTGCGAGGCTCTCGCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGCGGCAATTTCTTGCTGATCACCTTCTCCA
AGTGCGCCTTGGCGTATGTCCACGCGCCCTGGTTCAACGGCTCTTCTTGCACGTACACGACCTTCTTCACATTGTCGTACTTGTCCATCTCCTCGGCGAC
TTGCTGGAATGGGAATGGCGCGAGCTCTTCGAGACGGATGATCGCGATTTCCTCAGGTTTGTCACTGCGTGCTTGGCGTTCCTTGACCAGATCGTAGTAG
AACTTGCCCGAGCAAAAGTACACCTTCTTCACGTCCGACACGTTGGCAATGCTGGCGTCACCGATCACAGGCTGGAAGCTCGTGTTTGGCCCCATGGCTT
CAAGCGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCGGAGCAGCGTCTTTGGCGCCATCACAACGACAGGTTTACGGAACGCGCGCTGC
TGCTGGCGGCGCAGCAAGTGGAAATAGTTGGCAGGCGTCGTCGGGTTCACGACGATCACATTCGTGTCGTGCTCATACTCCTTCCAGTCGACAGGAGCTT
TCTTCGTGTACGATGGTCCAAGCGCAGGGGTATCGACAAGCTGCAAGAAGCGTTCGACACGTCCACTCGAGTGGTCTGGGCCAGCGCCGTCGTAGCCGTG
CGGNNNNNNNNNNNNNNNNNNTGACGCATCCACTTGGATTCGGCACACGCCAGGAACTGGTCGATCACGATCTGCGCGCCGTTGAAGAAGTCGCCGAATT
GAGCTTCCCAAAGCACCAGGTTGCGCGGGTCTNNNNNNNNNNATGAGTAGCCATATTCAAACGCCATGACCGCGAGCTCGGACAAGTTGCTGTTGATCAC
CTGGAATCGGCCCTTGGAGTTTGGCAGGTGGTGGAACGGGAAGTACATCTCCTCGGTCACTTGGTCCGTGAACGCGGCGTGACGCTGGCTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTACCGCGACGACAATCCTGGCCGGCCACGCGC
ACCGAGTGGCCGTCACGCAGCAAGCTGCCGAACGCCATNNNNNNNNNNNNNNNNNNNACGCGCACGTCTTCTGGCGTTGCTTTGGTCAGCATTTTCTTTC
TCGATTCAACATGGGTACGTNNNNNNNNNNGTCGGTCGTGGGCTTGGATACGTGCGGGCAAGTTAACAGATTCGAGACCGACATCGACGAGCTCGCTCAG
CGTCACACCCGTTGACGGATTCGCGTACAGATCCTCAGCGCGCGGTTGACCCATTGATGCCCACTTGCCCTTGAACGCATCGATTTCTGTTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGTGTAGCCTTCCGAGACGAGTTGGAGCTC
TTTTTCCAAGTGCGCATTGACTCTCTCGACCAACTTGCGCACACCTTCCTCGGTCACGAGCCCCGTGGTCTGCAGCTCTTGGCTGTATTTGATCGGGAAA
CGACCGGCGTTGCCCACGGCTTCGTACATTTTTGGCTGCGTGAAACGCGGTTCGTCCACTTCGTTGTGGCCGTGNNNNNNNNNNTCAATCACAATGTCCT
TCTTGAACTTGTTGCGATACTCAACGGCGAGACGAGCCGCCTGGATCACGTGGGGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACGTGGTCGTGAAGCCGACCTGGTTGTTTACGATCA
AGTGCACGGACCCGTCGGTCTTGAAACCTGGCAATTGCGAGAGCGAGAGACCTTCTGGGACACATCCTTGGCCCGAGAACGCCGCGTCGCCGTGCAGCAT
NNNNNNNNNNNNNNNNCACCAGCATCGTTCTTGGCGCGCACTTTACCCGTGGTCACAGGGTTGATGATCTCCAAATGAGACGGGTTGTGCAGCAGCGACA
CGTGCACTTGTTTGTCGCCGTAGCGCTTGTCGACGGATTGAGCGATGTGTGACGTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTTGTAAAACAACTTGTGCGCAGGGTAGTCCAAGAGCGACACCAACAGCGCCAAGCGACCACGGTGGGGCATGCCGAT
GACCACGTCCGAGATGCCCGCGACGGCAGCCGCGTTCAGCACTGTGTTCACTGCCGGCAGCATGGCCTCAGCGCCTTCACCGGAGTATCGCTTGAACGAC
GAAAACTTCTTAGCCATAAATGTCTCGAACACGTCGGCCATGAGCATGCTCGTGTACGCATTGCGCAGGTCCGATGGCAATACGGGGAATTTATGGTCGA
GCGACTCGACGCACTGCGCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGCTGG
AACTCAAAGCCCATCTTCCCGCAGTACGCTCCACGCAAGTAGTCATANNNNNNNNNNGACACTCGCGGGACCAACAAACTCGCTGTTGACGGCGGAGGCG
ACATCGCGGTCGAAAAGCGCCTGGAAATTAGCAGGTTGCAGGTCCGGGACCTGCTGCTTGGGCTGCAATTTCAATGGGTCCAAGTCGGCCTCAAGATGAC
CGTATTGGCGGAACGCCGACACCATGGAGCGAACGGCGAGCGATTCCAACGACGGCGCCGACGCGAACGAAGCGCGTTGCATGGTGCCGACCATCGCGCT
TCGCGAGAGCGATGACGCGCTGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGAGACGCAGCATGAGAGGT
CGGAGGGAGGAGGAGGAGAGGAGGAGACGGCTGCAGGGAGGAAGCGCAGGGCGACGCGCGATCCAATTGTGATGCCGCGCGATGGCGACGCGCAACTGCA
AGTGAGCAGCTCAACGAGCAAGAGTGTGGGTCCAAAATGTGACTCATGATGCAATCTTGGAGTTGATACCTCTAGTTAACATTTGAAAATCCAAACAACA
GATATTGCCGTATATGGATTGTTGAGATAGTAATCCTTGTGTAAATGTGTGAAAATATTTTTTGAGAAAAATAGTATTATGAAGGTATTAAAAAGGATAA
AGTATGTAAAATGCAAGGAAAGCGACTTTGTAAAAATCGCTCGTGGTCGTAATTACGTCCCGTTACTTCAAGAGGTACACCTGTGAAAATTGATATTGAA
GGCGTCGTCATTCACGACGGAATGAATACATGCTTTTGCCATAATTCAGTAGCCGTGTACTGATTACTCCGTTTAGACTTTCCTCAGAAGAATTGGGTTG
ATGAAAAATACGCATATACATA