Description :
From Genome Similarity Track
Location :
Scaffold_57:302786- 305313
Transcript NameFunction/comments
Sapdi_VS20SDRG_13249hypothetical protein

Sequence
2527 bases(100 bases per row)
CCCGGCATGCTCTGCTACGTACCCGACGAGACCGACACGTGGCTCCTCGCCGAGGTCGAGTCGGTCGACACGCGCCGGAAGCACGTCAAGGTCAAGCTCG
TCGAGGGCGCCGCCGAAGCGCGCGTCGTCGACCTCACCAACATGGACGTTGTCCGGGCCATCGGCGGGCCGCAAGCCACCGAGATCGACTCGCTGCCTCT
GGCCATCACGCACAGCAACAGCGACGGCGTCGAAGACATGCGCAACCTCCGCTTCCTCAACGAACCGTCCATCATGTACAACCTCAAGCGCCGCTTCGAG
GCCGCGCAGCCCTGTACTTTATTTCTTGCTATTTTCAATGATTTTCGACATTTTTGGCTAGATACGTACAGCAATGACATTGTGATAGCCGTCAACCCGT
ACCAATGGCTCGGGCACCTGTACGGCGAAGGCCTCCACACGCAGTACCTGCAGCAGCCCCGGCACAACCTGCCACCGCACGTGTACGCAACGTCGACAGC
CGCGTACAAGAGCATGACGGCGTCGCGTCGCAACCAGAGCATTCTAGTGAGTGGCGAGTCGGGCGCGGGCAAGACCGAGACGACCAAGATCCTCATGAAC
CACCTGGCGACAGTCGCCGGTGGCCGCGACGACTCGACGATCGCGCGTGTCATCAACGTCAACCCGCTCCTCGAGTCGTTTGGGAACGCCAAGACGCTCC
GGAACGACAACTCGAGCCGGTTTGGCAAGTTTACGCAGCTGCAGTTCCGCGACGGGAAGCTCCGGGGCGCTTGCTGCGAGACGTACCTCCTCGAAAAGTC
GCGCGTCGTCTCGTTCGCGCCCGGCGAGCGCAACTACCACATCTTTTACCAGCTCCTGTGCGGCCTTCCGGTGGCGACGACTGCGTCGCTGCAGCTCCAT
GCGACGTCGAGCTTCCGCTACACGGGCGACGTGGCCGCCATGACGATCGACGGCATCGACGACGCCAAGTGGATGGCGCAGACGCAGTTGTCGCTCGGGC
TCATCGACCTCGACGCGAGCCTTCAGCAGTACGTCTTCGCTCTTTGATTTGCGATTGTTGAGACTAAGATCGTAGCACGTTGTTTGAAGTGCTCGCTGGC
ATCCTGCACCTCGGCAACCTCGACTTTGCTCCGACGGGCGAGAACGCGTCGCGCGTCGCCAACCCCGAGTCGCTCTCGGCCGTCGCGACGCTCTTGGGCC
TTGCGCAGGACACGATCGCGACGGCGTGCTGCAACCGCACGGTCGTCGCGCACCGGGACGCGGTCACGGTGCCACTCAACGTCGTCGAAGCAAACGAGAA
CCGCGATGCGCTCGCCAAAGCCATCTACGCGAGCCTCTTTGACTGGCTCGTCGCGCGCATCAACGGCGCCATGTCGATCCGTGACGCGTCGACGCAGATC
GGCGTCCTCGACATCTTTGGGTTTGAGGACTTTGCGCACAACGGCTTCGAGCAGTTCTGCATCAACTACGCCAACGAGAAGCTGCAGCAAAAGTTCGTCC
ACGACGTCTTCTCGACGGTCCAGGACGAGTACACGCGCGAGGGCCTCGTGTGGGACCACATCTCGTACGCCGACAACCAAGGCATCTTGGACCTCATCGA
GGGCAAGCTCGGCATCATCAACCTCATGAACGACCACTTGCGCCAGCCCCGGGGCACGGAAGAGGCGCTCGTCAACAAGTTCCGCGCCAAGGACAATGCG
ATCATCTCGTTTGCCAAGGTCAAGCGCACGCAGTTTACGATCCGCCACTACGCCGGCGCCGTCACGTACGAGACGGTCGGCTTTATGGAGAAGCACCGCG
ACGCGCTCATGCAGGACCTGCTCGACCTCGTGCGGTCGAGCACCAAGGCGTTTGTCGTCTCGCTCTTCCCGCTCGAGCAGCCGCCGACAGTCGACGAGCC
CGACGCGATCTCGTCGGCGGCGTCGACGCCGTCACCCAAGTCGAAGCTCGAGGCGTGGGTCAAAAAGCCCGAGCCCAAGCCGCTGCTCGAAGGACGCAAG
AAGGCGCTGCCGCCCAAGACGCTCGGGTCGCAGTTCAAGGCGTCACTGAGCTCGCTCATGGACACGATCGGGTCGACGCAGGCGCATTACGTGCGCTGCA
TCAAGCCCAACGCCGTCAAGAGCCCGACCGTGTTTGACAAGCCCATGGTCGTCGCGCAGCTGCGGTCGGCCGGCGTCATCGACGCGATTCGCATTTCGCG
CGCCGGGTACCCCGCGCGGCTCACGGCGCACGAGCTCTCGACGCGGTACGCGACCATGCTGCCGCCGTCGATGCTCACGGACGACGCGTGCGACGCGTTC
ATGCGGGCGACGGGCCATACGTCGCCGGTCGAGTTCCAAATGGGCAAGACGCTCGTGTACTTCAAGGCCGGCGTCCTCGAAGAGCTCGAGCTCATGAAGT
CGGACTTCTACTACGAGCAAGCGACGCTCGCGCAAAAGGTCGTGCTCGGCTTCCTCGACCGCATGCGCTTCCGCAAGCGGATGGCAGCAGCCCTCGTGCT
CCAAGCCTTTGGCCGCATGGCGCTCGA