Description :
From Genome Similarity Track
Location :
Scaffold_89:30277- 39384
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_89-snap-gene-0.32Conserved gene of unknown function
Pytve_DAOMBR484snap-pve_contig_89-abinit-gene-0.104Dual specificity mitogen-activated protein kinase kinase
Pytve_DAOMBR484snap_masked-pve_contig_89-abinit-gene-0.76Gene of unknown function
Pytve_DAOMBR484maker-pve_contig_89-fgenesh-gene-0.7Conserved gene of unknown function

Sequence
9107 bases(100 bases per row)
ATCCCGATCAAGGTGTGTTCGGTCGGTGCGTATTACTTACTGTGTTCGCTCTCGAGGTTGACGGCTGGCTCCTACATGCAGCGATTGCTGGAGGACCGCG
ACAAGGTACTCAAGATAGAGGCGAAACTACAAAAGGAGTACGACGAGCTGCGAGTGAGTCGTGATGTGTATTGCATTCGGAATTATCGTCGAGCATTTGA
TGCTGATTCCGTCGTGCCGTCACGAGCAGAGAGGCAGCTCGGCCAAGGAGAAAGAGAAGAAACTTCGAATGCTTTCCGACCAGAGGCGTCGAGTGGAGAA
CGTCAACGGGCTCATCGACTATCACATGCAGCAGTTTGAAAACTACCGGACCATGAAGATGAAGGTGGTCCAGCGATTGCATCATTTCGTGCCTCCATCG
CACTCACCGATTGTTGGTTCTGCCTGCTTCGTAGAAAGCTGCCAACGAGCTGGCGCGTTCTCATGCGTTTTACCACGCCAGGGGACTGGAGCTGTTCGCT
GTGCCATGTCAATCTGCTGCCAACATCCAGCCGAACACCAGTACCGAGGTGCGGCGTCCAATTGGGATCAGTCCCTAGACGGAAACCAGCAGCAGAACCG
CACTGGTGTATTAACTATCAGGTGGAAGTATCATGAATATGTGCTCCAAAATCGATTGTTATATCATTCTGTGCGTCTCCTTTAGGTGGCGAGCTCCATG
ATAAACGCGAACCCGGCTTTCCCCATCTCGATCAACGCCAACGTCCTGCCGGCTTGAAGAATCTGGTTCACGGTCGGGATCTTGTCGGATCTGACCTTGG
GGTACCCAGACACAACGCAGATTGTCGGTCTACCATTGCGCCGCTTTCGGATGTAACTCTTGAGCAAGGGCTCGATTTTGGCGATCGCGTCGTGGCGCAG
CCGAAATTCTTCGGATCGAAGGGTCATTCGCGTGAAGAAGATTCGTCGAAGCGATTCCTCCTCGTGGCTAACCATCATGCCGAGAAGGTTCGCGATGGCA
GAGTACATGGCGTACTCGTAAAACCCGCTGTTGTACTTGGCGTAGACGACAATCAACGTGATCGCAGTCGCCGCGAGACTCCCCAATGTAGCGTACACGA
AGCGGACGCGAAAAGACGATCGATGCAGGAACAGGATGGCGTTCAAGAAACCGAGGAAGTAGCACGGCGCAGCGGATTTGTTGTTCACACTGGCGCGGTT
GTCTGCAAGCACCAGGATGATCCCCATGCACGACGCGTACACAAAGAGAATGGCGGTAGAGATCTGCTGGACGGTGCGTGCGTACTGGTTGTTCATCCAA
GTCGGCGAGTTCCGATCAGCTTCGTCGCCGATCCCGTCTTCGATGGATGCCGCAGGCGACACAAGCGCTTGGAACTCCATGTTCGGCGATGTGGTGCCCT
CTTCCAGGAAAGACCATCGTCTATTCGCACTGGACGGCGAGATGACACCGCCTCGACTTACATCGGCTGCGTGGGTCCGCCATGTGCGGTAGTATTTTCT
GCCGCAGAGCACCATGACAGCCGGGATCGCGAGGAATGCTGGGATCACAAGACCGAATCTCAGCGCAGTGGCGGTTGTGTACACGTTTCCAAACGGGAGG
AAGCCCGACGAACGAGGCCGCAGGTACTGCCAGTCTTGGACAGACAGCAAGAGCTGGGAGAAAACCGCAGCGATAACCGCGAACCGTGCAGTGAGGTAGA
CGCGAAAGTGCAGCTTGCCGCAGTTGGGGTGCTCGAATGGACACGAGTCGATCAAGTACCAATAGTTGTAGAAGGCGGCCTCCACGAACGGGTTCTTGAA
CTTGAGCGTGGCGCGATTCATCAACACTTGCTTACGAGTGCGCGGATTGTGCAAGTCCCGAAGCACTTGCTCCGAGTCGAACCGCTCCTGGCAGAACGGC
AGCATCAAGATAAAGTTCCGGCGACGAAGCACTTCCTCCCGATAGTGACAGATCCCAGCCATTGCGATGCCGCCGAGGTAGTTGTATCCCTGGAAGAGCA
CATCTGTCCACGACTCGGCCGACTGCAGCACCCACAGCGACGTCATATGGCCGAGCAGCATGATGAAGACCAATAGAACGCTCGTCGTGAATCGCAGCCT
TGTGATCCCAAACAGCGGGATGAAGACGACGAAGAGCGGGATGACTGGTCCTCTCGAATGCTCGATGATCTTCTGAGCAGTCAGCGCTGCGGTGAGCACG
AGGAACGGCACCGCGCTATACCACTCGTAATAGCCGTCAAGACGGCGGACGAATGTGCAGGCGAATGTAGCGAGCAGCACCGGGAGTGCAAAGTAAACAT
ACAAGGTCCAAGTGACCTGCGAGCGAACGACAACATGCACACTTGTTAGAGCAAGCCAAGGAAAGCGGGTCTAAATGAGCGCACCTCGTTCGCGGAACTG
GTTGAATCGAATACGACGACGTCTGCGATAGCCTTGGCTGCCACAAACACGAAGCCCAGAGCCATGGCGGCGCGGACTCGGCGGAACGCATGGCCCGATG
TGTATACGCAGAATGCTTGCTCATATTCAGGCTGGAAGCGCAGCGTCCACACATTCATCTGTCCGCGCAAAATGAGCTGCTTGAAGGCTCGCTTCCGGCG
GATGTTGTACTTGAGGAGATGGAGGATTCCTGTTCACAGCGCGAATGGTTCAGACATCTCGTTCGATATTGTCGATCTTTGCGTGTGCTTACCTGGCAAT
GTCATGTCGGAGTGATCAGGCGGCTCGATCGCACGCAGCATCAGCAGATTGACGTCATCGTTCGTGTCCTTCCAATGGGAGGAGCGCGCACATGTCGCGG
CGCTTTCGACAAGCAAGTTGTCGTGCTCGCTGTTCTCGGAGACCATCGTCCCCGAGCGTCGTGGCGACGCAGCCCGGCCGAAGAGAAATCAAGAGTGATA
TCGCAACATGTTCCGGTGCACTGAGCCACCCACATTGTATCGGTGCTGTCCGATATCTTTAGCGAACTCGATGCGAATGGGCCGAGAACAGCCTATCTCA
TGCGCCGACGTTTCCACCTCCCGCAAATAGCAAAAAGCCAAACTTCAACAGTACAACAAAGGAAGTCATAGCTACCTGTTGGAATCAAGTGGCACTACTC
CCTCATGTACGTGCGACACCAGCCAGTGCTGACAGGACTGCTCGATGAAGTCATCAACGGTTAAAGCACGACGCTACCTCTAGCATCGCACCCGTCTCGA
TCGTGCACGGGTCTGCAGAGCGAACACTTGTACGTACTGATGCCTCTGAGATCATCTTCGATCCCACCGCAGCTGGAGCACATCTTCGATGGAACAAGGA
GCACGAAGCAGACGCGCCACGGGTGATGGAGCAACACGCGCGCGACGAAATGAGTATCGATAGCACATTCAAGAATGCTTGGTCGCCATGTGCAGGCTGA
GCTCCTCAACACGGCCAGCATCGATCGCGTCCGGGTCCCGTTCCCGGCAGAATGGCTCATCATGGAAGCGTGACAGTAGAGCAATGGCTCAGTAAAAGAT
AACGTATGTGTCCTTGCAACGATTCACCAGACCTCGCAGCAGATCGCATATCAGGTAAGAATTGATGTCCATCAAACTTGGGAAGCATCGGTACCTGCAA
TACCTACAGATCCTGATAGCCAGAGTGTTGCCGGATCGACTTTGACGACATGGTTCGCCACACCGGTGTGAATCATGGCAACAATTTGAGCGCGTAAATC
CAACAAGTTGAGTTGACACCCTCCACAAAAATCGACATTTTCCACTTTGGTTGAGCATGGGCAAGCCGCAAGACTACCCCGCAGCGCTTTAACCATTTGT
GGACCATAGGCTGCCTGCCACCCATGGCAATGCAGATTTTAGAATTTAGAATCGCGCTTCTTCCGCCGACTGCCGAGCCGAGCCATGCCGTCGTGCAGCT
TGCGCCAGAACGACCCGCGCTCGCCACCCGCCGGGCGGACAGGACTCACGTCCCCGCTGCCAAATAATTGCTGCCGGCGGTTGATGCCAGGAGAGGCTGT
CCAGCTCTGCGGCGAGTAGCAGTACTCTTCCAGCAGCTTGTCGCTGTAGAAGCATCGCTTCTGCATGATTGCAAACGGAGCACAGCAATCCAATGTTCAG
TGAGCGGTTGCATCCATGGAGAATCAACAGGGTCGCATACTTCTTCAAATTTTTCGTAGACGTCGTGCACTGGAAGTCCCAGAAAACTTGCCAACCCGAG
TTGCAAACTAGACAAACCCACCACACTTTCAGTGAGTTTCGAATCGAGTGGCCATCCGTACCAGTCGAAACGCACCTCATTTGAATTGGCTCGATGGAAA
TGACGCGTCGAGAGTACGTAGGTGTAGCTTGTGACATAAACGACATCCCAAAGTCCGACTGCAGCAACATGTCAGCGAACTCGACAGCATTTCAACACAA
ATCATGACACTGTCGAACCTGTGGCTGATACGAAAACTTGGCGATGCGCTCGTACAAGTGCCGATACGCAGCGTCGGCAAACGCGTCCAAGTCAGTTTCG
CGGTCATCGCACAAGTGCTTCTCATCGACGAAGTGGAGCCACTGTACATCCATCCCGATCAATGTTACTGCATGGTCTCGGACAAGAAGCAGCAGAACAT
CAAATACCTCGCTTAGCGTTTCCTCAGCAGTGTACTTGTGTAGGAACGGGTGATGCAGCAGCTCATCAGCAGAGGGTCGATCATCCGGCTCGATTGCCAA
GCACTGAGGACAGCAACAGTGTATGTTAGAACTCATAAACGTGGCACAGCGGTCGCCAGTAAGATCGCAACGCAAGCCTCACCGCTTCCACGAACGATCG
ACATTCATCAGAAAACTGATCGGGAGGCAGCTTCAGACTTTCTTCGTTGGCGACCTACACGAACGCAAAAGCATAATCAGTAAAGTGAGTGCTGATACAA
ATCAATGGAAAGCACAGCGCAACCTACCGAGTCCACTAAACCGAAGAACCCATCTTGCGTCGGAAGCGGGTAGCGACCGAGGGCAACCGAGAGCAGCGCG
AGTCCACACGACCAAATATCCGCTGCGACACCGATTCAAAACGTCACATCTTTCATACTCGCAGCCAAATGATATCAACCCCACGCACCTGAATACGAAT
AATCGCCACCGCCAATTCGCTCCGGTGCCATATACAACAAGGTTCCCACAAACGTCTTGGTGCTGCTCAAGTTATCGTTGAGCGTTCGCGCCAAGCCAAA
GTCGGAGATCTTCACTTCGCCTTGTCGATTGGTCAGCAGGTTGTGGGGTTTGATGTCTCGGTGAATCATGTGCTTTCGGTGGATGTGTGCCAACCCGCGG
AGAACACCCGACGCCAGTCGAGCGAGAATCTTCTCGTTCTGGCAGCCCCCGCGCACAACAATATCTTGGAGCGACCCTGTGCTCATGTATTCCATCACCA
GGCATATGCAGTTCTTGGGACGGTCAACGAACGCGTCGTAGAAGTACACAATGTACGGGCTTGGACTGCAATTCAGCGACAGAACACCGTTAGAACAACG
CCACCCATGCAGGCAGGAGCAAGTTTGCGCACGTTGGCTTTGCCGTGCTTTTTCGGGGAGCGTCGACAGACTGGGGACTTTCTGTGTCCGACATGGGAAC
CAGATTCGAGTAGAGCGCGTGAAGCTCTCGAACCATTTGCCGGCGCTGGCCTCTTCCGTAGACTGGAACGTCCTGTGTCAATCAGACAATTAAGTAACAG
GTTAGTGATACACAAACCGTCTGCGATTGCAAATGCGTCAAAACACACCTTGACGGCTACAACTTTCAGCGTGGGGATATGAATACCCTTGTAGACCACA
CCGGATGCACCACGCCCAACCTCCTTCACTCGTTCCAGATTCTCTTGCAAGTGAAGGCAGGCAGCGTCAGGCGACGAAATCCCTGCCTCGGACACGGCGA
CACTTTTTGTCGTGAACATCCCGTGGTTTGGAGAGTACGCGCTGCCTCCGCTATGACGGCCAGCCTCTGTACACACATATCAGTGTGAGTGAACTTGTGT
CCAGTAAGACTCAATAACCCGACAGTCGGAACTTACCGCTCGGTGAAGGAAGGTCAGAGTCGCTACTGGAGCTGTTGTAGGACTGGAAGCTAAGCTTCAT
GTGCGCCACCTGCGCAGCCGAAGGACCTCCTCCATTATGTGCCGACGTTCCTGCCGCAGAGGCCGCTGCTGCTGCGATCTCCATGGCCTCTCGTTTCGCG
ATCAGACGGTTTGCAGCTCGCTGTGCTCGCTCTTCAGCTTGTTGGGGAGTAGGCATATCTTCTAACTTCAACCGCAATTGAGGTCGCTTGGAAGACCCCG
CTTTGCCCAATGGAGCGGGGAGAGGCGAGAAATGTGGAGGGTTGCGCGGAGTCAAGGCGTCTGTTCGAGGCGTGAACGCACCTTCCATCTCGAACTGGGC
CGCCGCCATCGGATGCTCCGCCTNNNNNNNNNNNNNNNNNNNNNNNGCGAAAGTTCTTCGACGACGCTGTCGATCGCGGAATCCAGCTCGCCTTCTGTAT
CTCGGCTCGTGTTCCTGGGACTAAACGACCGGCGCGAGTTCTCGAACCTCCGAGCAAGCGATAGTTTCGGCGACGACGCTGACGAGAACGCTATGCCCGG
CTGCATCTCGTAGTAGTTGTCGTGCATCGGTTGGTGAGCGTCATGAGTTGCGAAGATCATCTCAGGATCCTCCTCCTCATCAACGGGGAACTCGCGATCC
ATCCAGTCGCACTGCCAGGACCTCACCTCGGCGATGCGCAGGTCGCGCGGCCGAATATCCGGGAAGATGTTCATAATGGTCGGGTCATCTGCCTGTAAGT
TCGCATAGGTTAGCCGTGCCGCATAGAAACTGGCGAAGAACGACGACGCATTGTCTCACCTCGGCAATCAGTTCGGGGGCCGAGTACGACCGCAGCCGCA
GACCGTACTTGCGCGCCATCCGCTCCAGCTGGTTCGGCTGGTTGTGGTGAGGGGTGGCGCGAGTCGCGCGGAAGCTCAGGTAGTGGCCCGTGGTCGCTCC
GCGCAGGCGGGCGGCGGCGTTGTGGTGGTCGAAGTTGGCGCTCTCGACACGCCCGCGCTTGCGGAGCCGGTCGCCGAGCCCTAGATCCGACACGTCATCG
CTCTCCGTACGTTCACTAAGTGGCTGCGCAGATCCCGGCCCGTCCTGTTCCGAACTTGAAGCTGTGGCAGGTGACTGCGCCGAACAGTCGATGCGGTTGG
CGGCGCCTCCGCCCTCGGAAAACGCGCGCGCCAGCAGCGACCGCCCGGCGTCCGGCGGCGCCGCGTACGCAGAACGGCTCGGGAGGTCGGAGGTCGGGTC
GACTGGCGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCGTGCTGTCGCGCCGGTTGCTCACGCGCGCCGCTCATGCTGATCTGGTCTCG
CGCGTTGCCTTTGCCTTTCCTCCCGCGTCCTGCTGCGATGTAGCATTCACTCTGTTCAATCTCGCGAGATGTATGCTGTTCGCTGTGTAGCTTCGAGACC
GAAGCGACCTACACTCTTGGTGTATGGAACAGAACCAGGTCGGAAACCGGTACGAAGATTCAAGTACCGGGGGAGATCCGGTACTGGAATCGGTTTTTGG
ATCAGCTGTTTACGCTGGTGATGTCCATCTCCGAGACATCTCTTGTGGCTAAAAATATCCTAAAAATATCCTTGACCGGCGCAGTCGTTGCAGTCGATAG
GACAGCACCAAATGAATGAGGCAATGGGAGCAAGCAGCAGAGCGAAACCACCTCCTGCTGCGGTTTCTATCGGCTCCCCGAGAATAGGCGGCACCATGGA
CAAGGGCCACGCCTCGAACGGAGCGGCCGCACTCTCATTGAGCGATCGAGTGCTTTCGGCTCGAGTTCCCGACCCGCGCTAGACGGATCAGCGAGCGTCT
CGAGTGTGGCGCCATGTGGAGAATGGGACGCTGTCGAGCGCTGGCGGCGGTGGCCGTGGCGACCATCGCCGCTGGATTCCACGGTGGTGTCTCGGTCGTG
AGCGCTGAATCTGCCGGCATCGACTCCGCTACGAGCAGCTCGTCGACGGCGTCTGGAACGTGCTCCGCGAGTGCCGAAGCCGCCTGGCAGTCCACGTGCT
CGGTGCGCACGATCAACAACAAGGACTACATCCCGCTCTCTGGCATGGAATACTCGGAGATCAACATTGACGAGACCGACATCGAGGCCACGTACAACGC
CGCGCGGATCAACGCGCTCAAGCTGAGCGGCGCGGCAGGGAATGCGGCCATGGGCGGCATGCGCAAGAAGACGACGTCGTGGTACCAGCAATCGCTCACG
CGCTTCACGACGTATCTGTGCGTCATGTCGTCCGATGACGACGAGCTGGAGCGCTGCGTCAACGCTTCCAGCTCGCACGCGGCGCGAGACATTGACGGGA
ACTGCATCGCGCTCACCGGCGACGACGCGTGCAGCGCCAAAGGCATGTGCGAGCGCGAGAGCAACTGCAAGTGGGATGACCCGGTCGCGGGTGCCTCGAC
GCGCCGTGAGATCTTCACGAGTGCGAACGTCACGACGGCCAAGTCGTGGATGGAGAACGGGTACCCGAAGACCTTGGCGCCATTCGTCGCTCCGGGGATT
GTGTTCGCCGTACTGACGGCCATCACCGCCGTCGGGTTCCTCATACTCCGGTGCGTCTTCAATCAGTGCGGCGGTCGGAACCCGCGCGAAAAGGGCTACA
CGCGCTGCGACATCCTCGTGCCGAGCATCACGTTCACGGTGTGCTCGCTCGCGGTCTTTATCTGCATGGTCGTGACGGCGGCGCAGAACACCAACATCAC
GGAAGGCGTCAACGGCGTGCTCTACTCGGTAAACACGACGCTGGAGAATGTCGAGATCTTCGCCAGCAACTTGGAAACCCCGCTGAAAAGCACGGTTGCT
CAGCTTGCAAACGCCTCGACCACTGTGAACTCGAGCGTGCACGATCTCGAGTGGATCGCGAAGGACGGCGCCACGCTTCGCCAGATGATTGCCGACTACA
GCGCCATTTACTCGGCGCAGGGTCCGTTCCCGAACAAGACATGCGACAAGACGAGTTTCGCGTGCATCTCATGCCCCAGCTCGGTGTGTGGCACTCCGCT
GGTGTCG