Description :
From Genome Similarity Track
Location :
Scaffold_122:30274- 34549
Sequence
4275 bases(100 bases per row)
CGCAATGCAATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTTTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTAAGGGCGGCGACTAAC
TCGCCTCACATCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTACGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGATCAACGTGCTTGCGG
ACGCCCTCTCTCGGCGTCCTGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGC
TGTCGCGCCTATCGTCAAGTTCCTAATGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAG
GAGGGCCTCCTCTATTACCGGGTGGAGCCCACTGATCCTCCACGAGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATG
ACGCGCCCTCCAGCGGCAACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGT
TAAGACATGCGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGT
CTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGCATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGATACATCTTGCTCCAGTTC
CCGTCACTGTTACGGGCGAGCAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCGCCGCTATCACGGTCTCCCGGAGGCGATTGTCTCGGACCGAGACCCG
CGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGACCACCCGCAGACAGACGGCCAAACAGAGC
GCGTCCATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAAGCTACCAGTTGTTGAGTTTGCGCTCAACA
ACGCGATGCACGCCTTCACCGGGGCTCACGCCGTTCTACTTGAACGGCTTCCGCACCCCAGAGTGCCTCTCACTCTTCAAGGAGACACTGACTCATCTAT
TCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGGGAGACCAGTTTCGCTGCGGAAACAGGTGGAATTCTTTATGGACACCAAG
CTGAACCTTGTCAGCAGGGTCCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACAAGTAAGAGGAAACTTAAGTATATTT
GAGGTTGGGGACTTAGTGTTGCTAGACACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCAT
TTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTGCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTT
TGACCCGCAGGAAGTTGCTGACCCGCAGACCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGACGTCGGAGCAGGCACCC
AAGCTTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGC
CGGGTACGCACCATACGCGTACGTCTGGAGTGTGCCGCAGGCGGCACCAGACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCA
GATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGGCCCGCAAGACGAGCGAGCTCGCCTTG
ATTCCCGGCCTGGGCGGCAGCATCACCGCCAGTCCCAAGGCCAAGTGCAAACTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGTCCTGT
GTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAAT
GGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAAA
ACTCGTGGGAGCCGATTGAACGGCTCGTGATAGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGCCTTC
TTGCCCGAACAGGGTACGGACGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCTGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCT
TGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGGAGTTCTCGTAACTCCGTAGGCGAGTA
CTTAAGAGTCTCCACTCCACGCCCAGAACATGTTCTCACAAGAACTTCACGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCTCAAAGAGATAGAGA
TCACTCTCGGGTCTCGGGCTTCTTACGACAGTCGTGAAGTCCTTACGGAGATTGAGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCAA
TGATCACCTGTTCTTTCTGAACAAGGGCTCGTTTCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGACCACGAGGAGCGACGAGAAGCTCTGAGAAGA
GGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGGGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCCCCCCCCGCACA
CGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACGATAGCACCCTCCTCTTCCCCTTCCTCTTCTTCCT
CCTTCTCCTCCTCTTCATCCGAGGAGTCGAAGATACTCCGATAGGAGCGACGAGTCTCCTTCTCTTCGCGGAGTGGAGACTTAGAGGCGGTACTCTTCGT
TGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAACACGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCGGCT
TTGGGAGTGCCCTTAGCCTTGACGGCCGGACTCTCAGAGCACACAGAGGTCCTGGGACTGTGATCACCTTGATCACTAGCGAGCGACTGCACGCTGTCAT
CTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGATCCCGCAGGAGCATCGTGAGTGCTCTCGGACTCGGCATCGTCCTCACTGGCCGAGTTGAA
CTCACGTTCCACGAACCGAGGTTCGGACGATTGTCTGAAGATGAAGGCGACGGGCTGCGGCGCTTGCTTGCGCGCTTGTCCACAGCCGCGTCACCCGAGA
AGCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTACCGGCAGCAGCCTT
GGAGCGTCTCTTTGCACCGCTCTTTGCAGTGCCACGAGGCATGGTAACGGTCGAATTGGAGACCTAGACGAAGAGCGCACAGGTTGCTGCTTGAGGCTCT
AACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACACCTCTTCATTTTGATTGGT
CGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGTGTATGA
CACGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCGTTCAAAGCCAACCATTGGTCAAACGACATTGCATTTCTATAGGTAACGTATAGTTTGT
ATTAAACCCAAACTTAATCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAACTAAAGAGGGGACCTGTTAGCT
GCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACAT