Description :
From Genome Similarity Track
Location :
Scaffold_15:302718- 304293
Sequence
1575 bases(100 bases per row)
GCGGAGCTCGCGCACGTTCCTCCGGCTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGAGCGACTTCAAC
GTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCAGCCGATAAGGCCACGAGGAGCCGAGAGCTTCGCC
AACAGCGCTGGCGCACCAGTGCCAGGCTCGGGCGGGAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGTGGCAGTCG
GCTGCCTGGTATACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCACCCTCCTC
GTCCTCAGACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTTCGCAGCG
GCAGCCGCTTTCGACGCTTGGGCACGCTCACGACCTTGTGCCAGCGTCAGATGCTTGGATGCCAGCACCTCCTTGGGCTTGGAGCCCGCGTCGCTCGGCG
ACTTCTCGGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTCGTGCGACTGCTTGCTGTCGCCTGAGCCGGACTCGGCGTCCTCCGCCTCCTTCTCTGA
CGAGGCCTTTGCGTCGGCCGAGGCGTTGGTCATGTCGCCTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCG
GGTGAACTCTCACCGGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCGCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGC
CTTGCGCGGCGTCAGGAGACTTGCTTCGAGCCCCGGCCTGACGGCCACTCTCCGGCGTGCTGCTACGAGAGCGCACCACCTCCTCGGCCGCCTTCGTGGC
CTCCATCAGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCCCGCGGTTTCGGAGGTGCTTTTGCACTGCGCGCACTGCGC
TTTGGAGGCATGCTTCCGGTCGACGTGGAGACCCTGTGGCTTGCTCGGCGATGCGCCAGTTGCTCTGTGTGGCCCGGGAGCCGAGGCGCCAGAGCTCGTG
CCGTTTTCGATGGATTTCGACTTTGCGAGTGAAATGTGAGTCGCCGGCGTAACCTCGCTCTGATTGGTCGATAAGATCGAATCTAAGTGGGGGAGGATGT
AACGGGGTTACATGGAATAGTGACCCTGTCACTATTCTGGGATGGCTACATCGGTCACTCCCCTGGATAGTGACCCAAGTGGCCTCAGAGCCAACAGATA
CATTTTGTATGACACAAACTATAGGGAACTTAGGATCTGTATGCAGGCCAAATCTGTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCA
AGTCAAGTCGGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACA