Description :
From Genome Similarity Track
Location :
Scaffold_504:3027- 4944
Transcript NameFunction/comments
Hyaar_Emoy2814242AlNc14C139G7208

Sequence
1917 bases(100 bases per row)
CTGCGTCAATGGCAATCCAAAGCGATCCGACGAAGCTATCATACATCTCACGATCTTGTACCTTCGACTTGTCTTTGAAGTCGTAACTTCAGATACAACT
GACAAAGTGTCCCTCCTAAGTGTTCATGTCTTGGTAAAGAAGGCCGGCATGTGCCATTATACTGTCCTCACGGCTCTTGTGTCATCACTTCGCGTTAGGT
TTTGAGTGAACCTGCAGATCTGCGGTTGTTTGCAGCATTTGCACGGTTTTTGTGCTGGACCATGAACCACTTCTTTCCACAGCTTGATAATACAAAGTGG
GCGCAATACCACAGCTTCTTAGATAAGCATCCCAGCTATACTATCTGTCGAAAACTCAAGCTTTAGGCCATTTGTATACTCGCTGCGTTGTAAGGGAAAA
TGTTGTTGTATTCACGCCAGTAGCAACGTACTTGACTGCGTAATATCATGATAAGCAAGTCAGTCAGCAAACAATACCGACATCTGAAGCCGCCTATTTG
TCGTGTTGAAAGATACACCCTTCAAGTATAAAGCGGATAGCTACGAAAGCCTATGATGCACATTGATATGAGCCGGGTGTAGAAAATGTTGATATTCGCA
AGGTGGGTCGTTGTATTTATGTCGCGGTGACATCCCACGTCTTAGGAATCGTGTAAGACACCACTAACTTAAAAGTCAGGGATCACGACACATCCGCCAG
ACCGCGACGGTGCTACGACGATGCAGCTTATACACTTGCAAGAAAGCGAGCAGTGTGTTCAGTTAGTGCTTGTTCAAAGCGAACTTTTGTGTCCCGCGCG
AACACATAGTAGTGTGTCTGCATCTACGACTTGGTCATTTAACATGGGTGGCTGTCTTAACCAGCTAGTAGTGCGTTTCAATTTCATCAGTAGCTATCGC
AATGGTTTCGAGTGAAGCCATAATTTTTCATCTTGTCGGGGTGGCCTCTCCCAGTCACTCAGCCGTCGCCAATGGATTATGACATGACAAATACATCCCA
GCTTGGCTGGTCCATCACGCGAGTTGTTCATTTCTCAAGGTACAAAAGGGGGCCGACAGCGAGAAAGCCAAACAGGACCTATCACCCAACACTAACAATC
CAGAGTCCAATTGCTGCAATGCTAGCGGAGGATTAAAGACGCAGCAACGCGACGTACATTGTTAGGAACCATGCAAGATCTAGTAGACATCTCCACGGTG
TTTCAAATCAAGAAGACAAACCCGAGCATGGTGGTAAAATTCCACCCTGCTCGCGCTTTGCGCATAACTTTTAATCACCCGACTCGTTTGACAAGTGCGA
AAAGCTGTTTGACCTCTCTTGCTCCGCGATCTCTTTCACGTGGGGAAGATGCAGCACAAAGGCCGATCCGATTCTGGGGGCACCTCCAATCGAAAACGAC
AACGGAGACTCCCTGTCTGTTAGTCAACGACCGTTTTTGTAGCTACTGGCGCCCCCTCCAGTTGCTCATTGCCTGTCTTCTCCACTGCCTTTGCTTTCAG
CTCATTCTGACCTTCGTACACGTGCTGCTTTGCTTCATCATTCACAATGCTGATTCGACTCAGCTCGTTTTCGAAATGGGAAAACTGCAATCGAATCTGG
CTAAGACTATCTTGAACGTCGGCGTGTTTCGCATCCATCTTCTTGTGCATCTGAAACAACGCCTGCTCTGATAATGCTAGACGTCGGGACAGCATCGACA
ATTTCGCGTCGATCACTTGTTTCATTGTCGTCTCCATTTCGCTCTCCATTTTCATCTGGAAGTCTCTCAGAAGTATCTCAACATCCAATATAGACGCTGT
GCTATGACCGCGTTGATCCTCATGCATCGCAGCTGCCACTTCTACAGTACTGTTACACCGTCAACACTGTCAGACACGATAACCCCAATACTTTTGCAGG
TGCATACCTGCGTTTTA