Description :
From Genome Similarity Track
Location :
scaffold_5:302654- 303986
Transcript NameFunction/comments
g8154.t1hypothetical protein

Sequence
1332 bases(100 bases per row)
CCGCCGTGCGCCAACGAGAGTTGGTCAGAATAGAAAAACGACGATTGCAGTGACATTGTCGCCGCTACCCCTTTGCAGAGCCTCGTTGACAAGAACTTGC
GCGGCTTGAGATTGCTGGGGGACGGGTATGAATCCCACCATATCCACGACTTCTTGGTCACTAAGAACATCCCAGACGCCGTCGCATCCCAGCACGATAA
AGGGATAGTCCTCCGCCGGTTCAAGTCTGGAGGAAATACATTTTAGAAGGCAGCCGTTGCGACGTCAGATACCATGGTGCAATATTGGCTCTCGGGAGAT
ATCTTTACCTCGTCGCGCTGGTGTGCGGCCTTGCGATCACAACCTGTTTGAGATTTCGGTCTCCGAAGCTCCTGCAATCGATCAGCCCACGTGAGATTGA
GCGCGTTAAACGACAAGACAGTGGGCAGGGCATTACCGGGTAACTGCAAGTACACCAGACACGCGATCTTGAATGACGAAGCCGCCGTGTTGAATAATCC
GCTCCATTTCGTCCTGGTCATTCGCTTTGTGGTCCTGCAGAGCATCAATAACAGCCATGAGCCTCATCGTTGCATAATCAATAAGTATCCTGCTCTACCT
TCGAGAGTCGAACTGCTTTTCCCTTGCAGCTAAGCACAGCCCGACTGCACGAAGCACGCCATACAAGTTAGCACCATTGGCCTGCAGCATCTTACTTTAG
TATCCACGCACCTATCGCCAACATTGGAGACGTAAAGTGTCCTTGCACAATTCTTCTCAAGCAGCAACGCTGTCACAGCCGTGGCGCCCACCGTCCCCGA
AAAAGACTGGCAGCATTCCATGTCGGAGACCAAGTAGCCCCTACACAACGACCACGTCAGTAACAGCACTTATAATACCATCAACAACACCCAGCCAACT
TCAGTCCTTACCGTTCAAGGCGCTGCTCAACTGTGCTTCCATCCTCGGCCAGCTGCAGCTCCGTCGCGATGTTCTTGTGTAGCACTCGTTGCAGGCACGT
CGACACGGAACGACCTACACAGCTCTTGTCAGTTCGTTAATTACGAAACTATCCCTAGATCGCACTATTACTACTAGTATTATAGTAACAGTGCTCCATT
ACCTCCATGTCCATCGTGGATAGCGAAATAGCCGTTCTTCGGGTGCTGCAGGAAGCCATCCACGATGCGGATCGTGTCCTCCATCGTCTTCCTGTGTCCA
GCGTTCTCCACACGACATACGCAACGTCAGCCGACACACTAGCAGCCTCATTGCACATATTAAGCAGGCTATACAACTCACCATTTCCTCGCAGACGCTC
ACGCATCTGCAGCAACTGAAGACCCCGTCCAT