Description :
From Genome Similarity Track
Location :
Scaffold_366:30265- 31670
Sequence
1405 bases(100 bases per row)
tactccaaTCGTGAATAACAATACACGAGAGAGCGGGAGAGCGGGAGACAGTGATCAATGATAGAGCTGAAGCTGTGCCGATTGTGCGGCTCAGGTTGGG
TCTCTAGTGGCTGGAGATTATTCGGTATCAGAACCCGAAAAAAAAGCCAAAGGTTGAGCTGTCGAAAGGGTTTGACAAGGCAAACAACGTGTACTGGGTT
TGTGAGTGTGTTTTCTACTGAAGGTATCGCCCTGGGGCTTCTACGCACGATAACGGACAGCAATATGCGGAAAAGCAGCTTCTGCGAAGGCAAAACAGAG
GTGAGTTCCTACGGATGAAGCAGGACGCGACAAAAGCAACTGAAGTGGCAAAGATCCTAGTAGTAGTTGAAATAGTAGTAATATGAGGCGGCGTCAAACG
TCAGAATACTAACGAAcctaagtacgaatcgcgatttaggcacaccatgaaaaaaaaagaaCGTCGCCTCTTTCATTTGAGACCACCTACGGTTTCCAGA
ATTTTGAATTGAAGAAGTTCTGGGCTCGCCAAAACATTATCTCCCTTCCCAGAATAAAAATCgtttttatttatttattgGGGGGATAGGGGTAAAATCG
GCTTGCGGATCGAATGGTGCCGTCAGTTACTCCAATTTCACTGCGCAACCTATTCAAATACGCGTTGTTTTGTTTCACCCGGATTAGTGATACTCAGAGG
TCATTAGTATCATTTTCATTTGCCAGGTGTATGAAATGATTATCGTCATTGTGAGCTTCGGCTCTAGACTACAGTAGTCTGCGACTTATTTCGCATTCTC
TTCTTACTGGTTGTAGTCGCTTCGCTCGAGACTTTTCCACGACGATCGCTGTTCTCCTTAGCAGCTATCGCCATTGCCGCGCGGTATTGCCTACGAGCTT
TTTTAGCAGCCTTCGCATTGTCTCCTTGTTCCTTCGTGGAGCGACGTAGATCGGATCTGACTGAAATTCATCAGGTACGTATGGGCGGATTTTGTTGTAC
AAgtccgtcatcttctccgcATTTTCTGGACGGGCGCTCAGGTGCTCCAAGAAGTGAGTGAGCATGCGACtcaccttctcgctctcTGTCAGCACTCCGT
CTACCTTGCGGTGAAGATCTTGCCCTACGGGCTCATTGTCAGGCCCCTTCCTGCATTGCACGACACCGGTTTTTTCTTGTACCATGGTAAAGATCTGATA
TTGCTGCTCTCCCACCAACGTCATGTACAGTTCGGTCGCCAGTGGTTTGCAGCTTTTGAAAAAAAACGTTCCCGCGCGAGATATGCACTGTTGTGCTAGA
GCTCGTAGCACCATTTACAGCGGAAACTACATGCTCCATCGTCCAACAGTTCGTGCGACCGATGTGCTTGCGGATGTGGCCAAAGCCACAGTCACACGAG
ATTTT