Description :
From Genome Similarity Track
Location :
Scaffold_104:30245- 31386
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19145myosin-like protein

Sequence
1141 bases(100 bases per row)
CGGACGAGGAGCGCGCGGCCAAGATGCTGGACGACGCCGCGTACGATGCACGTGTTGAGGAATCCCGTCGCAAGCGCCGCGAGCAGATCGAGGCTGAGCG
TCGCGCTGAGGAGGAGCTTCGCATGAAGCTAGCGGCTGAGGCTTCAGAGCGCCGGCGCATTGAGGAGGAGCGCAAGACAGCGGCACTTGCAGCCAAGGAG
GAGGCTGAGCGTCTCGCTGAAGAGGAACGTATTCGCAAGGAGAAGGAGGCCGAGGAGGAGCGTCGTCGTCAGGCGGAAGAGGCTGCGCGTCTCGAGGAGC
TCCGACTCATTGAGGAGGAGGAGCGTCGTGTGGCTGAAGAGGCCGAGGCCGCGCGTAAGGCGGAAGAGGAGCGTCTTGCCGCGGAGGAGGCCGCTCGACT
GGCTGAGCTGGAGGCGATCCGTGCTGAGGAGGAGCGTCTTGCTGCTGAGGAAGCAGAACGTCTTGAGGCCGAGGAGGCAACGCGTCGTGAGGAAGAAGAG
CGTCTCGCTGAGGAGCAGAGACTCCGTGAAGAGGAGGAGGAGCGTCTGCGTCTCGAAGAAGAGGAGCGACTTGCTGAAGAGGAGCGTATTCGTAAAGAAG
AGGAGGAAGTTGCTTTCTTGGCTGCTCAGGCTCGCGAGGAAGAGGAGCGTATCGCTCGTGAGGAAGAGGAGGCGCGTATTCGTGAGGAAGAAGAGCGTCG
TGCGCGCGAAGAGGCTGAGGAGCGTGAACGCAAGCTGGCGGAGGCAGCGCTCGCTGCTAAGCGCGCGGAGGAGGAGGCCGAGCGCATTCGTCTGGAGCGA
ATCCAGCAGGAGAAGAACGAGAAGTACGAGCAGTCTCTGTCCAAGGACGTGCCCGTGCTCGTTCGTCAACGTGGCCCTGGCCGTGTCGTCAGCTACGACA
AGCAGCGTGAGACTTACGCCGTCAAGCTCGAGAACTCCATGGGCGGCATGCAGATCACTGTTCCTAGTGACGACGTCAACCTGGATGACGACCGTATCCT
GTCCCCACGCACCAAGGTGGACACGCCGTTCGGCACGGGTGAAGTCGTGGGTCTTGACCCGCACGTCGGATGCTACGCTATCAACACGGAGGTGAACGCA
CCAGACGACGACCAGTTCTTGGCGTTCGTTCAGATCAACGA