Description :
From Genome Similarity Track
Location :
Scaffold_216:30230- 35005
Transcript NameFunction/comments
Hyaar_Emoy2812740hypothetical protein
Hyaar_Emoy2812741hypothetical protein
Hyaar_Emoy2812743hypothetical protein
Hyaar_Emoy2812742hypothetical protein

Sequence
4775 bases(100 bases per row)
GAAAACGATGCTATTAGATGCGCATCTTCGCGCTCTTCGGTACGTGCAATTGCCAGCGTTGGCTAATACAGGGCGTGTGGTAACTTTGTTGTGTGGACGA
TGTAAATACAGCTCTGCAGGCTTTGCGTTTTCAACAGTTCTTCTACAAGACGGAGAGTTTGTTCATGTAAACAAGGTGCGTTTCTTATCGAGAGAGAGCA
AGCGATGCACATGCGTCTGCCGACAGTGCACCCCTTCACCTGCCGTGTTGTCTTACTCATTATGTACAACTGCCGTGTTGAAACGATAGGGCCGTCAACA
CTTCTGGCGTGTTGTGGAAAAAGACAGCGTCAATGGATCCATTAATGCGCCGTGTGTATTCCTCTCATGGGAGTGGGTTTACCAGGGAGTTTCTCAACGG
GGTATCTCCACAGAATGCTGGGTACGCATCAGTCATTACTTGATCCACTCACTACTGCATCAACTCTGATCATTCCGTGTACACTAACTCCTTGTATTTC
CCTCCTGTAAGTTTGCGATGAAGAATGCCAGTATGTGTTCGGACGGGTGGGTGTTTGACCCCCGCCGTGTGATAGTCGAAGCCGCTAAGGTGCGTGCTGC
TTTATGCTTCAGCATCAGTGTGCCTGGGCTAACCTGACGACGTGCACGGTCGTTTCATAGTGTGGCGTCGCAATCGTGCGCACTGGTCAGTTCTTGCGCT
CAGCGTTAATCTCCGTGCGTCCTCACGCGTCGCACTTGCTATCGTTCACATCCAATCCGGCGCCAATCGATCGCGGTGTCGTCGCCCAGCGGCAAGCCCA
GATGGTGCTCTTCTTAGAGTCGATTCTCCCATGCCTCGTCGCTATTGTCGAAGAAGCATATGAGCTGGGGTTGTCCAACACCGACGATAGTGACGAGTTC
CGCAAGGTCTTTGACGACGAGAGTATGTGGCGCACTGTCGACTCGGAGCTGCGCGATCCACCGGTGGATAGCGCCGAGAATTACTCGTGCGGCATTTGCA
AGCGGGAAATCACCAATTTGTACAAACAGTGTCTGGGCTGCGCGGTGTACTCACGTCGGTGCCGCCCCAACATGACGTACCCGATCTTCCGCATCTGTCT
GCGCTGTCACGCGCAGCCAGAGCAGCACCACTTCAAGCCGCGCGCGATTGCTTCGTATTACGACAAGGTGCTGAGCTCAGAGGGCCACACGGGCGTGCTA
CCGGCCACACGCCGCTACCAGTCGGTGCGCAGCTACTTCAAGTGTCGATGTATGCCGTCGCTCCGCTGCGCGTACTGCGGCGGGTGCGAGTCGTGCTGCT
GTTTGTGCCACACGCTGTTCCAGACGCGGTTCCGGTTCACGGCTCCTGGTGCGTAGCCTGTTTGACGCGCTCTTTGTAGGGCATTTGGACACGAGGGGGT
GGCTGCTGCTGCATGCTTCCACACCTGCTCCTGGCTGGTTGACTATCTGGCCTAGACTGACTGACTGACATCCGGTCGGTGGTGTGTTGTGCTCTATGTA
TATGTGTCTGTCTGTTTGTAGCGAGCCTGGAGAGACTGCGGGCAGACGTGGACGCGGTTGTCAAGTACCATCAGCACCAACTCCAGCAGCAGCTGCCGCC
GCCGCAGCAACGTTAGCGTCGATGGAGTGGCCGCTCAGCTCTATAGTTTGCTGCGAGGCAATGGTCGTGGATGGAACGTGTGCAGCGTGCGCGGGGGAGG
AGCGTACGTGCGGGTCCAGCTCGACCAGTTGGCGTGATTCACTACAGTTTGTTCCGAAGAAGAGCGATTGTTTGTGTGTGGGTGTGTGACTCACTCACTC
ACTCACTCCATCCATCGGTATTTATACCTCCTTGAGGGACAGTCCGGCACGTTCAGTCTCGAGCGGGTCGCGATGGAGATGGGTACACACGGATGTCAAC
TGCTGGAAATAAATACGACGGTAGACGTTGCGTTTCGAGAGATGGTTTATCGATCCTGAGACTGCCTCTTCTACACATGGCTGCATGCCAGCAAGGACAT
GCAAACAGAAAGGAGTCTTTGGGTCTCGCTTTTTGCTTTTTTGTCTGTCGTTTTTTTGCTGTTTTTGTCGTCGTTTTTGCCCCTTTGTTCCTCGCTTTTT
GCCCCTTTGTTCCCCGCTTTTTGCCCCTTTGCTCCTCGCTTTTTGCCCCTTTGTTCCCCGCTTTTTCGACGTCGTGTCTCCAAGTCGGGTGTATCTGGCA
AAAAAGTGCTTTCTAGCACTTCACGATGAAACCTACTTTCCCTTGAAGTTGCTGCAAAAGTTCAATTGAACTGGAATTCCATTCAGGCAACGCACGCCCA
GATTTGACACAGGATTCCATGAGCTGCCTCAGCGCATGCGTGGGCTGGGCGGCCGCTCCACTGTCGCATGTCGCATGGAAGAAAGCTATAGCACGCTTAG
GCGCTGCGGCTTGCCACGGCTTGCGGAAACACAGAACCGCACCGCTAGGCCAACCATTGGTTTCACAAGCGCTCCAATGCTTGTCATACATGTTATAGCG
TTGCGACGACGCGACTTGCAGCAGCTTGCAGAGTACTTGCTAAGAGATAAGCTAAGAGAGCCATCACAATACTGTAGACGGTGCAGCAATCGTGGCGTAA
TCATACTTTATAGTGGATTTTTGGGAATAGCTACACGATTTTCATTGCATCAGTATGTAACATCTGCAAGTGGTCGCGTTTATTTGCATGCCGTATATAA
ATTTGTCTTGCGGACCAGCGCTCAAAATTCGTACATCAGCCGACAACTGCGTGGCAACCACTTGGTCAACCGCTGCTGCGTTCGTGCGCGGCATTATCAT
ACGCTAACTGCGTTCATCTCTTTGACGCTGTTCTCATATTTCCACTACCTTCACTTTCGACATGAGGTAGAACGCATCCTATAGACGCACACGAAGACCA
AACAAAGGAAATGAACGCGAGAGCGCGCTGTGTAACCGCGGCGTCGCATCTACCTTTTCGCACAACAACTGGCTGTTGTTGCGCGTGAAACATGTTTCTT
CGTTTCTACCGTCCGGTATGTAACCGCCCTTTCGGCACAAGCTGTTGGTCGGTACTTGAAGCTGCTGCAAACCAGCCACAACCACCTCCACCATTAGTTT
GCCGTCGTACGACTTGACCCACAAAGATGCGACATGTCGTCGAAGCACTTCCATCACAACATTGGCCAAGGAGACGCGCTTATCTTCCGATACAAAAAGT
GGTGATGCATACTATTACGATAAAGTAAGCTTGAAAACGAGACTCCCACGAGACGGTTGTCGTGTCGTGTGGTCTATCTAGACGCTTTGTAAGGACGGAT
GGCGGATCGGCAGAAGAGCCGTTTTCACGCGACCGTTCACACCTGGATAGGCGCACATAGGCTTGGTGGTGGACGCGATGTTCGTGTGGCCACCACTCGT
GCTGCTGCTGTTATTGGATGTGGACAGCGTCGACAGCATCACCTTGAGGCTCAGACGCCTCAGCGCGTTCAGCTCCACATTCTGCGGCTCGTGTGGCATC
TCGGGTGACGTCGGGCATTGCACCTGTCGTAGACGTCCACTGCCGTCCTCACTGCGTGCTTGAAACGCTGACCCAATGGACTCGAACGAGGTCTCCTCCA
TGTCCATGTCTATGTCCACGTCCTGTAAGGACCCACTGCAAAGTGACTGAACGCTCGATTGCAGGTCCGTGACCAATCCGTGGAAATGCTCCAAGGGAAA
GCCCACGTTGCCATCGCCACCGTATTCGAAGCCAGCGTCGAGACTATGGTCTTCCACACTGGATCCCATGGCCGAGAAGCGGTTTTCAAGGCTGCAGTCA
GCACTGGCACCTAAGGGTCTGTTCATGTCGAGTGCCGTGAGGTTGAGCGACCCGAAGTTGCGCTTCATTTTGATGTGTGTCAGTATAGTGTGGTAGGAGG
AACTGTCCGGGATGGAAGTGATGGTGGTGGTAGTTTAGGTCGAGAAAGTGAAATCAAGTGCAGGCACGGTCGAACGGTACTCGACAAAGAAGTCACACGG
AGGACGAAATGCTGCAGCAGCAGCAGCTTCCGAGCGGACAGAAACGCGGGGGCAGAACTCGGAGTGACGGATTGTCCTCCAGTCACTTTCCATTCGAGGG
GGAACTTGTCGACTGAGCGAGCTCCCAAGTCCGCGGCTGACTTGATATCGGGTCAGTTTGGGAAGAGCGACGGGGCGCCCGTAAAACCATGTAAAGAAAA
CGCATATTCAGCCTAACAACTCACGTCTGGCTCGGTTTTGTCTGCAGCGTCTCATGGCTGGGATAAGCAGCTGGACGGCGACCAATTGCTCAATCGCACC
AGATAACCACCATCAGCACGGCAACAGCGCATCATTTGTGTAGTCCCTCATAGTCTACCCCCCACCCCTTCGGCAGATATTGTACTAGCTGCTACATATT
CGCGTCGCCGTAACGTTGTTATATGTATGACAAGCATTGGAGCGCTTGTGAAACCAATGGTCGACCTAGCGGTTTGGTTCTTTATTCCCGCAAGCCGTGG
CAAGCCTCAACGCCTAAGCGAGCTTCATAGAGCGTGCTACAGCTTTCTTCCATGCGACATGCGACAGTGGAGCGGCCGCCCAGCCCACGCATGCGCTGAG
GCAGCTCATGGAATCCTGTGTCAAATCTGGGCGTGCGTTGCCTGAATGGAATTCCAGTTCAATTGAACTTTTGCAGCAACTTCAAGGGAAAGTAGGTTTC
ATCGTGAAGTGCTAGAAAGCACTTTTTTGCCAGATACACCCGACTTGGAGACACGACGTCGAAAAAGCGGGGAAC