Description :
From Genome Similarity Track
Location :
scaffold_349:30229- 32298
Transcript NameFunction/comments
Pl_105795hypothetical protein PHYSODRAFT_257507

Sequence
2069 bases(100 bases per row)
CATAGCGGAATGTAAATCAAGGCGGTGGTGCTCACTGCTGCATGTGTGTACTTGATAGAGAACGCTGCGCTCTACAACCAGCGCGCGGCAGTGCTGGAAC
AGATCCGAGTCCTGCAGGATCGGTACCAGACCGAGAAGAAACAGTTGACTGCTATTCAGGACAAGTGAGTGGCAAAAGCTCGCACTAGTCGAAGAATTGA
ACTCACAAGTCACTTCTGCGTAGGAAGGAGCGCTATAACCGACTGCAGCGAGTGAAAGCAGCGCGTGACAGAAGCGTGGCGATGTTGCGCCAGCACTTGG
CACAGTTGGAAGCTGCTTCACCACCTGTGCGACCTGGAAGCTCTTCAACAGAGAATGTCAGTCGTGCAGCGACGCCGACAGGGATTGAGTCGCTACCAGT
GATGCTGACTGGGAAGAAACCCAAACGAGTTTCTGCGACGGAATTCAAGCAACTCATGGACCAGATCCGAGCAGTGAAGCAGGAGCGACAAACGATGCTA
GATCCTTACGTGGGGAACCTCAAGGTAATACGTCTTGTCATGTAGGATGACGCTGATCAACTGGTTAAAGCTGTCTTCTTGCAGCTTGCTCGACTTTGGG
ATCGCCTCCATGACACGGCGCGATGTCTGGAGAATTACGACGCCGCATGCCAGATGATGAATGAGAAAGAACTCGAACGCATACCACCGGAAATGATTGA
GGAAGTTCTGGAAAAGCAACGACTAAGGGTACGCAGTTGTGCGTTGTGACTAGTATGTGTCCACCAATATTTCCACTGCTCTTTGAAGCGGAGGGCGGCA
CTGCATTATCTATTTACACGGGCGCTGCAGCGAAAGCAGCGCCAAGAGGCTGCAGGTATGATGAACAAACTGTAGTAGTCGCGATGAATTTTACTAATTC
GCTTTGTTCAAAGACTTACTTTCGAGGTTCATAGCTCTCGCACTTCCAGACGACAGACTGAAGGACCTTGCTTACGTGGACAGGTTTGTAGACAGATCGC
AGGTTACCTACCATGGTGCCTAACTGTAAAAGACAGAATTCTGCGCGAGCAGGAATATATCGAGGACCCGACGCTCGACAGCCCGGACGAGATCACATTT
GCTATTCGAAACACCAGCAGTCTAGGCCAGTAAGTTTTCCTGGCTTTGACTAAGCTTGCTTTGCTGACGATACTTCTGCTAGTTTGACAGACCTCCGCTT
CAGATTGCTGAAAGAATTGCTTGCTGCGTCACCGACAGATCCATGTATAAGTTCATTGAGACATCGTGCTTGTTGCAGGTATCTCACTAGCGTTTTGTGC
TCTTGTGATCTAGATCTCATTGAGTCGGTGGCAAACATGCACGTCCGTAGGGGTGAGTTCGCAGCAGCAGAAGAGCTCACTACTCGCTTCGTTGCACTGC
CACCTGTTCGGCAGATATCGCTATTCGCCACATTCGCTGAGCTGCGCTGCGGGATGTAGTTCGTGCAGCGAGATTTGAATATCATGAAGAACTCCAGCCA
CTTCAGTTCTACATGCATTTACAGGAATTAATTTAGTCCGTCTTCGATGCAGTCATATATATTTCAAGTATCGCGTCAGCAGCTCGCGGCAATAGCCGCC
AGTGCCTAGCACATGCCGTCGAGAGTCTTCATTAGATAGCCACTAGCGCCATCGTTACCCCTCATAATGCGGTTATTTCCGTCGAGATCTTCGGCAGTTC
GGCACTTATCAGGTTGAAGGGGATGGGTCGTATCTTCCTTCCCCCACTTTTGGCAAATACTACTCCGATTTAGTAGAACACCTTTTTAGTCTCCGACTTA
TGGTCTCCGTAATGAAGTCTAGTTTGTTCTATGTAAAAATATATAGAACCAGTAGAAGAGGCTATCTTAAGAAAGCAATGGCGGCTCCAATAGGAGGAAA
AGGAGAACAGTCCCGCGATGAGTAAAAATATATAGAACCAGGTCGCACCTAACCGAGGAGGCTATCTTAAGATAGCACAGAGATGGCACAAGCAGAAGCT
GCTCCACACCCAAGCACCAAGAAACGCCAGACAACAGTGCATGCAGCCGCGCAGATTAAGCTCCACGTC