Description :
From Genome Similarity Track
Location :
Scaffold_5:30226- 52427
Transcript NameFunction/comments
Phyta_totarag370hypothetical protein

Sequence
22201 bases(100 bases per row)
TGTCCCTTAACAATCGACAGGCTTTCAAACAAGCTGATCGTACAGAGCCCCACCAAGTTTGATTTCGAGGCGAATGCTCTCGTTCGCTGCGTTCTGCTTG
TTACGGATGACGCGCCACTTCCAAGGTCGATATACACCACTGTTTTTATTCAGCTTACTGACGTGAACGAAGTGCCCATAATTTCGACGGGACAACGTGG
TTATATCAGTGAATGTGCATCTAGAGAACAATTCGTTATGACTGTCCAGGCGTCCGATCCTGATACATATCCTGTGTGGTCTTCTCTTCGATTTCGCTTA
CTAAACACCAGTATTTTTGCGATGGATCCCATGACAGGGGATGTTTCAATACTCACGCCAGGGGTGCTCGATTTTGAAACGAACTCGGAGCTTACACTTC
AAATCCAAGTAACAGATGGTGGCTTTCTTACTGCTGAAGCCACAGTATTTGTATCTGTCTTgaatgaagaggaggcgcCTCAAGTGTCCACGTCTTATAG
CTTGGTTATCCCAGAAAATGTAGCTGTTCCTCGAtcgctccttcttgtcaatGCGACCGACCCCGATAGAATCTCCCAAGATAAGCTGTCATTTTCAATG
GTGGAAGACTTTCAAGAATTTGCAATTGACGGAATAACCGGCGAGCTCATTCTGCTCAAACCTCTGGATTTTGAAATCGTTCACTCGATAAACCTGACTA
TAAATGTTGGGAAGCGCGGGAGTACATTGAACACCAATTCGACAGTTTCTATTGTAATCACAGATCTAAACGAGGCACCCGAACTCTTTCATGGGACTAC
AGTTGAAACTGTAGCCCAAGAAAATATGGTAGGGGGTTTGCCTATTGGGGCTTCCCTATCTTCTTTTGTTTGGGATCCCGAAAACAATACGCTGAGTTAT
GTTTTGGACGCTTCCGAGTTCTCACCATTTTTCGCGATGGATGGTTGTACAGGAGAACTACGCTCGAAAGAACCTCTGGATTTCGAAACGATGCCAAGGA
AAATTACGCTGCCTGTATCAGTTTACGATTCCAGCAAAGCCCGCTTATTTTTTTCTGTTTCGGTTGCTGTCCTTGACGTTAATGAGCCACCAGTATTTGA
TCAGACTGGGTACGTACTGACGGTTAATGAAAACGCAGCAAGCAAAACCATGGTCGGCTTGGTTACAGCAGTTGATCCTGACAAGGATAACCGATTGGCT
TACTTTATCAAGTCAGCTGCTGACAGCAGCGCTTTTGATATCGATTCAACGACAGGAACAATTCAAGTGTCCTCATTCGCTACGTTGGACTACGAAACGC
GAACTTCATACACGCTTCAAGTCTGTGCGACTGACAGCTTGTTGGAAACCTGCACCGCAGTGCTGATTGTCGTACTTGACATTAATGAGCCGCCATCGTG
TCCATCTCAAGCGCGATTTGTGAAAGAAAATAGCTTAACTGGGACAGTCATCACACCTCCGATCGTAAGTTATGATGCTGATGCGAGAGACCTGGGAACG
TATCCTACTTTGTCGCTAATTGATGTTGAAGGCATTGGCGGCTTTCGCATCGACAATGCGTCGATTGTAGTGGAAGGCTTGGTTCTTGACTACGAGACCC
AAAACATGTTCCGATTCCAAATTTCTGCGTGTGACACAACTGGCgcgtgcagtacatgtaacctCACTGTTCACATCACCGATGTTAATGAAGCCCCGGT
AGTTCCTAACCAGGTAACCCAAGTGGCAGAAGGCACCAACACCTCGTTTTATACCGTCCAGGCTTACGATCCCGATATCAACCAGACGAGTAGCCTTTTG
TACGAAATTCTTGATCAATCTCTTTCAGGGGTATTTTCTGTGGATCCCGGAAGTGGATTAATCAAGGTTGCAGATCCAAAGCGCCTTAATTTTGAGACTG
TAGAACTTCATCAAGCTTGGATCAACGTGCGTGTGACTGATCTAGGAATGCCCCCGCTGTCATCTGTTTGTCATTTGGTGATTAATATTCAGGATGTTAA
TGAAGCACCGTCAAGCGCAAGTACTATTGATGTATCGGTTCTCGAAAATGCAACGATTGGAACCGTAGTGCTCAAATGGAGCGTTCAGGACGAAGACACA
GGCAAGCAGCTGACGTATCAAGTGATTAGTACCGAATTCACTGGTGTAATTAGTTTCCGCGATTCTGACAGCCCCGAAGTGACTTTGGAGACATCACTGA
ACTACGAAACAACAACTCAATATGCGATTGTGCTGCAAGCTTGCGATCCGTTGATATTGTGTACTTCTACTCTTCTTCGAATTGCGGTTCAGGACTGTAA
CGAGCCCCCTTCTTTTTTGCAAAAGACCGACACATATCTGGAATTTTCGGTGGCTAgtcatgctgttgctggaacTGGGATTGGTGTACTGCAGGCTGTG
GACCCTGATTACGGCGATATCTTGTCGTTCTCGGTCTTATCCTCGGCAAGTATACTGACGGCAGGTACCAAAGATGGCGTTGGCGTGTTTTCTGTTAATC
AGCAAACTGGTGGACTGAAAGTTGGCTCCCCACAAAGTattcaagaacttcaagcaGGGTTCAATTTTATACTGACGGCCAAGGTGACCGATTTAAAGCA
ATTATCTGCGACTGTCACTATTATCATTGGCGTGGTAGCAAACAACGCACCGCCGGTCTGCCAAACGAGCCTCTCAGTCTATATGGATGAAAATGCTCGA
ATTGGTACTCTAGTTGGGTTGCCGTTAGCTTCGTACGTGACGGATGCTGATACTGGAACTACTTTCGCCTTCTCGCTACAGCATTCGTTTCTTTCTGTTA
ATCCTAGTACTGGACAACTATTTGTGACTTGTGAGACCAATCTCGACTTCGAATCTGGTACTCTTAAGTCGACAACTGCTAGCGTAGTAGTGACGGATGA
TGGAGCCTATCACAACGGTCTTAGCACACTGAGTACAAGTTGTGTCATATTAATTGTGGCCAGAGATGTCAATGAGAGCCCCAGGACAACAAATGTTTCT
CTCAGTATCACAGAAGGTACGTTAAATACTGTGTTTGCATTGGGTTTTCACGCTCACGTGCTGACGTATGCTTGCTGTTCCCAGGTACCAATTCTAACCC
ATCACGCATCCTACCGACCGAGATGTTTGCTTTTCCTATTCTTTCGTCTCAAGCCGACTATAGTGTCGCAAAGAAGCTTACTGGAGGTTATTCGGTAAAC
ACATCACGAAAAACACTTCCGATGGGGTATGACACCTTTATCCAAACTTCAGTTGGAGTTGTGCTTCAATTTGAAGGCGTCCAACTTCCGGAAGTGATCG
ATCATCTTTCACTGGCGCAGTTGCGCTTCACGATCCCATCAGGAAAAATTGGGCCGTTTTCACTCCAAATACGTGTGATGAACGCATCCAGCGTTTCATG
GGGTACAAACCAAAATTTGGAAAACTTTGGTATGCCCGCCTTTGTGCAGTGGACTGTGGATAAAGAAGTCTCATCGACCACTATTTGGTCGCCGAACATT
GCCTCGATCTTTGAGGCGATAATGCCTGATATTttgagcaccagcaatgTGGCATTGCTCATTTTGGGAGGTGGGATAGGAGAGGTAAGTGCTTTTGatc
gcagcgctgcaactgctgctgttcttgaaGTTACAGTAGCCCAAGGTAAGTCTGAACTAATGTCTTCGATGTTGCCCACGGATTTTGATACTACGATTAA
CAAAATCGATTGGTTTGTTTGTGCACATCATGTAGCTTCACGAGTATCCCTTGTTGGCGGCATGATATCATATACTGATGCTGACGCCCTGGACGTCGCA
CAGTTTTCAATCGTGCAAGGCAACACACACAATCCTGTATTCTTTGTGGACAAGAGCACCGGCGTTATAACGGCGAATGTTGATCTCCTGGACTATGAAG
TGCAAAACAGCTACGAACTTTTAATCTCTGTCACTGACAAGTTGGGTTTGGCAGCCATCTCAATAGTCGATGTTACTGTCGTCGACGCGAACGAGCCACC
TATTGTGAACGAGAGGGTCTGCTATGTCGCAGAAAACACACCCGTTGGAACAGCCATTTGTGCCGTCAGCGCTTCAGACCCGGACAACTCCGAACTGGCA
TCCGGTAAATTGACGTACTACCTGGCTCAGTTTTTAAATACTCAGGGCGGTATCTTCCAAATTGATACGGTTTTGGGGATGTTGCTAGTGGCAAATTCAA
CTGCTCTTAACTATGAAGTTCGGCAGCAGTACGTAGTAAGTGTCTGCGCCAGGGATGGCGGAAACCCATCTCTGGACGGATGCGGCTCCGTGACAATCTA
TATTACTGACACGAATGACGCGCCTACTACAATTTTTCCCCATACATGTGAGGTGGACGAGTATTCGTACGATTTGGACAACAAACAACTGGGTCAGTTT
ATCGGTGTGGTGGTGTGCTCTCTTACTGTTCTCGACGAAGACTCAGATAGTGCTGCAAATAGTTCGTGGAAGAATCATATCTGGCAGAATGTCGACGCTG
ACTTAAGTTGCCCATTTAGCATTAATTCTCGAGGTCAGATCGTCGTGAATAATCCTGAACGTGTCAATTACGAAGAACGACAATTATGGTCTTTGCTGGT
ACAAGCAACGGATTTGGGAGGGATGTCAAGCCTCCCACAACGAATTGAGATTCAAATTCTTGACATCAACGAAAGACCTCAAATAGTCGCAACTACGTTT
TACGTCGACGAAAACTCTCTCGCAGGGACCTGGGCAACAGGAAATCTGACTGTTTTTGATCCAGATCTGCGCAGTGATGGCCAACGCGATACTGTTATTG
TCAGCATGGTTGGTCAGATCGACATGTTCAGTGTTGTGAACAACAGAGTCCAATTAATGCGTGATGGATTAGACTTCGAAACAAAGTCCTCATACGTGAT
TTCTGTTGTGGCGACCGACGAATCTGGAGCAAAAAGCAACGTCCAAAACATCAATATTGTAGTCAATGATGTCAATGAAGTACCAAATATTGACTTCATG
CAGCTTTCAATTTTAGAAAACCAACCTGCTACGACGAAGATTCTTCCAGCTGTCAAAGGAAAAGATCCTGATGGGGATAGTATATCCTTTAGTATAATTT
CAGAAACtccaaaagctgcagctgcacgagctccaaCCGCATTTGGGATTGATACGATTACTGGCGTTTTGTTCCAGCAAGTGGACAAACTAGACTTTGA
AGAGACAGGTCAGTATGTTTTGGTTGTAAAGGTACGAGATAGCACTGGGCTGTATTCGACCGCCAACGTTACGATTACGATTACTGATGTTAATGAAGCA
CCCGACATCCGGGACCAGAATGTCAGCATTCGCGAAGATGCAACTATTGGTACTCAAGTGGGGCAAGCGTGCGCTACAATTACATCAGATCCAGACTTGA
AAAATGGGTATGAGGTGCTTACATTTACATTCCCAGATCGTGACCAATCTGTCTTCTCCATTGACTCGAAATCCGGTCAAGTGACAACGTCAGCGCGCCT
TGATTTTGAAACAAAGTCTAGCTACAAACTACGCGTGCGTGTTGTGGACCACAATGGTTTGTCTGACGAAGCTGACTTTGTTGTAACTATTGTTGATGTC
AATGAGCCACCAACTATTGCTACATTCAATATTTCTGTACCAGAGAATTTGACGCCAGGATCAGTCATTGGAGATCCGATTCTAGCGGTTGATCCGGATG
CAGACTCCAATCTTGAGTACGATCTTGACGGGACAAGTGACGGGGTGATGGCTTGTATTAGAATCAATGCATCTACTGGACAATTGCTTCTGAAAGTTGA
TTGCTGGCTCGACTACGAGTCCTCTTTAGGAAGCACTCGGCCAGTTGTCGTACGAGTCTCAGATGGAGAATTCACTGCTTTGACAAAAGGTACAATTTAC
GTCACAGACGTCAACGAACCTCCTGTGCTGGTAGCCTCCGTCTCGACATTGTTGAACGAAAATTCCCCCGACGAAAGTGTTGTGACGCTTATCTTGGTCC
AAGATCCCGACATAAATGAACAGCACCAGTTTTGGGTCTGCGAGCAAAGCAACGCAAATACTTTTCGAATTCAAGTGACGGGGCCGGACAACGCAGAGAT
TGTCGTTCGAGATTCGATGGCGCTAAGCTTTGAAAAGACTACTTCGTTTTGGGTCGACGCGTGTGTTCAAGATAAAGGCAACTTAACGGCAAGGGCTCGG
TACAAAATCAACCTTGTGAATGTGTTTGAGCCACCGTACTTCGTGCAGGAAATAATTCAGTTCACGGTAGAGGAATCGATTCCTGTTGAGAGCGTCGTAG
GTTCGCCGCTGTCTCGCTatgttgtcgatgaagagAACCTGAATGCTATCATAGGATGTTCGGTTGAGATGAACATCTTGAACAGCACTTGTGGTCGCCG
TGTGTCTTTTTCTCTGGATTTTTGTGGACAAATAAGTCTCGCAACTGGTGGGTTGGACTACGAAACGATGCCGATGTGTGTGATCTATGTCACACTTCCT
GTTACGAGTATTTACAATGCAAACACATCATCCTTGCATCTGATTGATACGGCCGCCGTGATTTTAACTGTGACTGAGGTGAACGAGCCACCTACGTTCT
CACAAAACGTGTATCAGTTTGGTGTTGCAGAAGCCGCTATAAAAGGCAGCCTTGTTGGTGTTTTGGTAGCTTCTGACGTAGACGCTCGTGCAGTTCTATC
ATTTCAATTACTGAAGGCAGAACTTGGGAGTGAGGGAACGTTTATGGTGTCAACCTCGGGTGTAATTACAGTTGAAAAAGCGCTCAATTTTGAAACAAAG
CAATCCTATCAAGTATCAATCCGAGTTCTGGACGAGCAAGGAGCTTACGCTGATGCAAGTGTCGTCATCAGCGTTACAGACAGCAATGAACCACCTGTGT
TTCAAGCTAGCCAttacagcttcaacgtcgtgGAAAATTCCCCTGTGCAAGCCGTTGTGGGAGATATTGTCGCGATTGACAGCGACACGCACCAAAACAA
TACGATAACCTACAGCATTGTCCGCGGAAACGATTTTGATGCTTTTGCAATTCTATCAATTTCTGGGGATGGAAGATTGGTGGTGAGCTCACAGCAAGCG
CTTGATTTTGAACGACAAGAATCATATACCTTGCTAGTGGCAGCGACTGACAGCGGCCCGGGAGGATTGAGCGATTTCACGACGGTGTCAGTGCTTATCA
TTGACGTTAATGAAGTTCCACAAGTGTATTCCCGAACGCTTTATATTCCTGAAGATGCTGTGATTGCAACTGGAGTATTCACGTCGCCAGCGCTCAATGA
AACTTTCTCAGTAAAGCTACTTGCTTCAGATCCTGACACCGCTGACAGCTTGACTTTTTCAATAACTGACACAACCGATACATTTTCTATTGATCCTGTC
ACGGGAGCTATTATATCGAAGCAAACGCTGAATTTCGATAAGAAACCTTATTACTCGGTCTTTATTTCGGTGACAGATCGTGGCAATATGTCAGCAACTG
CGGAGGTGGAAATCATTGTTTTAGACAGAAATGACGCTCCAATTATTACCTTAACGACATTTTCTCTAGCTGAAAATCCAGCTCGTGATTTTGTGGTTGG
TGTTGTTCGTATAACAGACGAAGATTACAACCAGCAGCATTTCTTTGACTTGGTAGAAACCTCATTAGTTTTCAGAGACAACtcaacaagcacaagaaca
AACAATGATGTTGTTTCGATTGAGTTGAAGTCGGGGTCAATTCAAGTTGTGAACGAAAGTATATTCGACTTCGAGACGATACGCCAGGTGATACTAGTAG
TGGCGGTTAGTGACGATGGCAACCCCATACGAAAAACTACTGATTCGTTGACAATTGACGTGGAGAACGAAAACGAACAGTGTGTTTTTACAGAAACTAC
GTTCACGATTTCAATTCCGGAAAACGTGGTCGGAATGGCTGGTCAAGCTATTGCAGTTGACCCAGACGCAAACTCATCTCTGGTTTGGGGTTCGATAAGC
TACTACATGATCGACGATGAAATAGCAAGCAGTGCTGTGTCAGTTTCGAGTACTGGTGAAGTTATGGTTAAAAGGCCTCTGGATTTTGAGATCCAACGCA
AATTCTCTTTCAAGGTGGCTGCAGTTGATGGCGGCGGTTTAATTTGCTCTTCTACGGTTCAATTACTGGTAGAAAACAGCAATGAGCCTCCCGTTATTCA
ACCCGATCATTTCTGGGTGCCAGAATCGGTCGACGGGAATCTAGATTGGGTGCGAGCATTTGATAATAGCCACGCTCGTGTATCATTTTGGGACCCAGAA
AACGACTCAGTGACGATTGTGCAAAACTCATCGGATTACTTCATGATTTCAGAGGAGGGGTTGATTTCGCTAGCGAAGCCTGTCGACTATGAAGTAAAGT
CGTATTATGACCTTCTAGTTACTGCTGTTGACGCTCATGGGCTCCGGGCAAGCTCAATAATACGCGTTGAGATTGTAGACGTAAACGAACCTCCAGTATT
TACGCCTCCAGGAGACATGCAgattgctgaagatgctTCAAGAGGGGCAGTTGTGGGGGTGGTTGGATCTGCGTATGACCCGGACGAATATGATACGGTT
TCCTACCATCTAGAGACAGCAACTGATCGCAACGGTGTGTCCGTAGACATTTTCATGATTCACGTATGTGATGGAGAAATTCGCATGAGCAAGGCTAATG
CTCTGGATTACGAGACAAATGACCGCTTCGTGCTTACAGTAAGTGCAACAGATCGCGCAGGTGTACAGGCATTTTCTGGACCTGTAGTTGTAGAGGTCTC
AGACATCAACGAGGCACCGCAGTGCCAAGATGGGACACTAACTATGCAAGAAAATGCTACATCAAGTGAACTATTTGGTCCGATTGAGTGGAGCGATCCT
GATTCGACCACCAAAAACACCATTACCGTGTTTGAAGTGATCAGCGATCCAGGTGAAATTGGTTTTGGCATGTTTGAAGTTCAGCAGGAGAATGATCAGT
ACTGGATTGCGTTGCAGCGTTCGGGAAGTCTAAACTACGAGGAAATGAACCTATACACAGCTCACATAAAAATTGGTGACAGCTTCGTTTTCAGAAATCA
ATCCAGTGGAACAGCGATTGTGTCttcgatgtcgtcgacgtgCTCTATTACGATCCACGTGTTAGATGTTAACGAACCACCGATTGTCGCAAGTCTGATT
AAAAAAACCGTTGAAGAAAACTCCCCACTATTTGCTCTAGTGGGTCTAACAATTGAAGCAAGTGATCCGGATGACCAGGATGTCCTCCATTTCTCGATTA
TAGCAGGCCAAGATAACTCGGTGCCGTTCACGATTGATTATAACACTGGTCAAATCCGAGTATCTGGTGATATAGACTATGAGACCCAAGCGATTTACAc
atttgctgttgctgtcaaAGATTCGGCACTTAACTCAGTTACGACACTCGTAGAAGTTACCGTGTTAGACGTGAACGAGCGTCCACAGATATCTCGCAAT
TGCTTTGTTCGCGAAGATGGCACCGCAGAAAATCGATACGAAGATAACAAACACGTGTGCCTAGAAGCAAGTGAAGATTTAGAAGTTGAATCTCTATTAC
ACCATTTTGGAGCTTTTGATCCCGACAACAACCAGCGTTTGTTTTATTCTGTGGCCGAAACCTCAAATCCCTTTGTTCGAATTGTACAACATGACGATCG
AAGCTGTGAACTTGTGTACAGTCGAGCGATCTTCGATTTTGAAAGTGCACAAATGCGTCGAGTGGAGCTAACAGTCACGGATACGGGCATAGGCTTTCTT
GCCGATACTGTCATGGTTTTCATCTTTGTCCTGGATGTTAACGAGCCTCCAGTATTTCTTCAAGCGTCGGCATCAAACCTAGTGATCCCAGAAAATGCTG
CAAGTGGGCAGCTACTGGGTCAGCTTAGAGGCATGGATCCTGAAGGTGACCAATTCGTATTTTCTCTGAAAGATTCCCGCCCGATTCCAAACGCTATTCA
AATTGGTGCAGATGGGCACGTTTTCACAACAGATATTTCACTCGACTACGAAGCCTTGGTAAGGACAAATTCCATTTGGAGTGAGCCAATGCTTACGATT
TGCGGTGTAATTTCTTCTTCCAACAGTGTTTCGACGTCATTCAACTTCACCATGTTGATGGTAGATGTCCCAGAACCACCCACGTTTGGCACGATGAAAT
ATGAGCTAGCTGTCCATGAATTGGCTAGCGCGGGGACTCTTGTTGGTCTCCTCCAAGCTACTGATCCGGACTTGAACGCCACAATGCAATTTACGTGGGA
TACGACTGATACTGGTACTGGTGTAGCAAGCAGCATATTTGATCTTGGAGCAAGTTCTGGAGTAATTTCGCTGCTTCAGAAAGGAATTCTAGACTCGGAA
TCTGCTCCGACCTACGAGCTCAAGGCACTTGTAACTGATTCAACAGGGTTAACGGATTCTACGACAGTGCACATATCAGTTgtggacgacaacgagcagc
CAATTTGCCCGACTCTTCAATGCTGGGTTCTCGAAAATTCTTCGGGGCTTTACAAAGGGCTGCCTGGGACTCAAGGATTATGTCAAGTAGTCGTGCAAGA
CTTGGATGTTGGTCAGAAACACGTTTTCCAGTTGGTATCCACTGCTGACAGCAGTACTTTCTCCATTGACTACACGACTGGCGTACTGCAGTTTGCTCCA
GATACACAGATCTTCGCTAACTTCGAAGTGCAAAATGTGTATCGCCTTCGTTATCAAGCGAATGATATCCCAGATACGGGTTTATCATTGGCTTGCAGCA
ATGAGATCGTGATCAGTGTTGTCGACGTTAATGAAGCACCCAAAATTCCAGGGAAGTCGCCTCTGGTTATATCGGAGATGAGTGCGGTGGGAATAGTGGT
TGGGACTGTTGATGCAATAGATGAAGACATGGGTGACACGCTGGCGTTTGCAGTGCAAATGTCGCCCTACTCACCATTTATACTAGACGCAGCCACTGGG
GTTCTCCGGGTAGCTAACGCAACCATGATTAACTTTGAAGTTTCACCATTGATGTCGATTGACGTCGTTGTAAATGATCGCGAGGGTCTTCGAGCTGTGG
CGACACTACTTGTTACGGTTATAAACGTCAATGATCCACCGGTGCTGCAACCAGCCAACTTTACAGCAAACGAGTACGCGTTATCTAAGAATGGTGCCAC
TTCTGGATTACGGAACTTGGAATTATTGGGGACTGTCCATTGCTttgacgaagatgttggTGACGAGCTGAAGTTTGTGCTACTGAACAATCCGGCAGAT
TTCGTGGTCGAAGAAAAGAGTGGAATGATGTATGCAGAAACCAGATATCTTGATTTCGAGACAAAGTGTGCCTATGATCTCAGTATTCAGTGTTCAGATG
GACAAGCAACCGCAATTTCAACGGTTTGGGTATTTGTTGTAAACATTAACGAAGCGCCGATTGTTACGGATCAAGTGTATCGTGTCGACGAGAACACACC
AGATGGCACAAGTTTAGGCTTTGTAAATGTTTCTGATGCCGAGCATGACGATGAAAACTTTTTGAcaattgctgcttcaacagtGGGGGATCCCAATTTA
GTATCTAGATTACAGGATAAAACACCTGTGTTTTCGGATTCTGCTGATTTTGAGTGGACGAACATTCCGGAACAGCTTACTAATGCTTTCGTTGTTGCCG
CCCCGACATCAGTGCCTTTATCGAACACTACACTGAATTTGGCAAGTTCAGGCAACTTGTTTGTCATTattgatgatgatgctgatgtcATTCCAGACTG
GATATTACAAGATGCGTTCATCAAGTTGGAAGGTCAAATGGTTACTGCTCAAAGTAGTGCAAGTGCAATGAGTTTTGACATTTACATTCGAGATGAATCA
GTCGGCGCTTTCGCAGTCCCAGACACAACTGGTTCTACGATGCTGTGTATTTTCGGCGCTTATCCATCTTCACTGGAGTATTTCCTTCACGGCTCGACGA
GTAACTGGTTTGAACTCACGTCAGCAGGAGAGCTGCTACTAGCCACCTCTACATTGGACTACGAAGCTCTGAATGCTGCTGACCAACCGCTTCAGCTTTT
TGTGAGTGTTGTGGATAGTGGGGGTTTGATGGGAGAGGCAACGCTTTCCATCTTCGTTGACGACGTAAATGAAGCACCTGTCATTACAAACTGTTGTTTC
GAAATCGACGAGAACCCTGGTATTGGCACAATGATCGGTGAACTCGCTGGAAGTGACCAGGATGCTTCCGACCAAATCAGCTTCGAGTTGGCATTTCCAT
CTACGGACATTGCATTAACACGAAGCGGTACCTTGACTGTACACAACAGTTCTCTATTTGACTTCGAGAAGAATTCGCTGGTCATGGCTCGGGTGCGGGC
TACTGACAAAGGTGGTCTATTTAGTGAGCGCGAAATTCAGATTAAAGTTTCGGATGTGAACGAGCCACCCGTTTTTCACCAGTCGTCCTACGCATTCAGT
GTGCCTGAAAATTCCGCATTTGGCTTGCCGTTTGGAACGCCAATCCGTGCAGTTGATCCGGACCGTGGGCAAACCGAAAACTTACGATACGAACTGGTGA
ATAAAAATGCTGGAGGATTACCTTTCCGCCTTGAGAGTTGTTCAGGTCAACTTGCAGTCCAATGGGACAAGCTGGACTACGAAAGTACGAGCCAATATAC
GTTTGGCGTGCGCGTTATAGATTCAGGGTATCCTGTAGCTCTGGAGGCGCAAGTACAAGTGGTGGTTGATATACTTGACGTGAACGAGGCTCCTAAATTT
GCCGAGTCTAAAGCACTTGCCATTCTAGAGAATGCACAAAATGGAACATTTATAGGTCAAATGCTTGCTACAGACCCGGATCAAGCGTCGGTGTTGTCTT
TCCGCACAAATGCCAGTGACTACGTTAACATATCGGAAAATGGGCATCTCTATTCTGCAGTGTCCTTCGACTACGAAACAATGCATGTACTCTACGTTGC
GATAACTGTTGAGGACAGTGGTGTGTACTGCGACTCCATCCTGGACGTATCTCAGTGTGGTCCAATTGCGACCTCAATTATCGTCATTGTGTCCGTACGA
AATGTCAACGAGGCCCCATCTCTATTCTCTGGCACATCTGCTATCCGTGAAAATCTCGCTCCAGGGTCGCTAGTTGGGAAACCCATTCAAgttgttgacg
ttgatgGAACAGTTGGAAACAATTCTGGATTTTCCATTACATTTGGCCTCTCGAGCGGAAAGGAAGCAGAATTTTCAATTCGTAACGATGGACAATTTCT
AACGCTTGTGGCCTTGGACTTTGAAAGCAAAGCTGAATATTCGCTAGTAGTGGCGTACACCGACGGTGAATTTACGTCTTACCTGAACACTACGATTACT
GTACTGGACGAGAATGAACCGCCTTCGGTTGTTGCAGGAATCAGTGGATCCGTTCAAGAAAATATGGCTGCTGACACAACAGTGCTAGTTGCGAAGTTTA
CCGATCCTGATCAAAATTCAACAACCGTATTCATGCTCGTAGATAGCTTTGCGCCCTTCAAAATTGACCAGCATACCGCGATATTACAAACGACTCGCGC
ACTAGATTTTGAAAAGGATCCTACAACTTTCAATCTCAATGTGAGAGTCTGCGACGCTGCCCAGACAACCTTATGCGGGAGTGGTTATGTTACTGTCAGT
GTTACCAATGTCCCCGAGGAGCCATCAATGGATGATATAACAtgcgtcgtggtggagaaTACAGCAACTCTTCTAGCTGAGCAAGGCACAACCGCATGCA
CTTTTATTGCTAGTGATCCTGACAAAGCTTCTTGCTCCTTTTACGAAATCGTGGGTACCAGTTCTCAATATCAACTTGTACATGACGCTACGGTGAATGG
ATCGGCTGCAACCGTGGCGCTTGGCTCAAAGGAGTGCACCAGCAGTCGGGTGGGGCTCGTTTGGATAGCTTCATCCTTGCCAGATTACGAGATTCAATGG
CAATACGTGGTCACCGTCCGAGTTTCGGATGAAACAGTGGCAACGACGGGTCTGTCTGTTGACAGTCGAGTTATTGTTAACGTTGTCAACGCAAACGACT
GCCCCACTTTGATCGCGTTGTCATTCACAGTACGAGAGCGATCGCCAGCAGCTACGCAAATCGGATACCCACTACCTGGTAAAGATCAGGATGTGTCAGA
TACTCTCTCGTACGCTATCATTGAGACGAATGCTACGTCTGGTTTAATTGGAATTGACTGGATGACAGGACAATTGACGGTGGGCAGGACGCCTACAAAT
ACCGAGCTCGTATACCCTGCTCAGTACTATGTGAAGGTGGCAGTGACGGATAACAGCGCTGTGAAATGCTCGACCAGTGCTATCATTAAAGTGATCACCA
CAAAGTCGAATTTTGCTCCAGTATGGCTTAGCACATTGCCCGCGTCGTTTGATATTAGTGAGAATTCTTCCGCAGGAACTCAAGCTGGCGTTTTGCTCTC
TAGTTTCGTCAAAGACCCTGACAACGACGCGATCCAATTTACGTTGCAGTCAAAGACGGACACGTACTGTGCGGACGCCTTTAGTCTTAGTTTGACAAAC
GGAGCTATCAAACTTCGTGTGGGGAGCACTCTGGACTACGAACAAAGACGCACATACATTTGCACCGTAGCGGCATGTGATCCAGATCAAATGTGCAGTA
CCCACGATGTAATTGTCCAAGTAAAAAACGTCAACGAGGCGCCAGCTTTCTCCGATGAGCTGTACACATTCGCAGTGAAAGAAAACGAAGCTACCAACTT
CGCATTTCCCCGTTGTCTCAGTGCCACTGACCccgatgaaggcgatggcTACGCTCTTACCTACGCGATGCCATGCGTCAATGCAAGCGACTGTTCTCTC
TTTTCTTTAAGAGTTGAAAAGGACTGCAGCCAGTCACTGTGTGCAAGAATTGTAGTCAAGCCAAGCTTAAACTATGAAGCAAGACGGCGCTACAGTTTTA
ATCTCACCGCACAAGACTCCGGTAAGCTGACAGCCATTGTGAAGATTATTATCGAGGTGGAAGATGTGAACGAAGTGCATTCCTTCGTTGACTTCCCAGC
GACGTATTCTGTGTTAGAAAACACGGCTATAGACTCGGTGCTGCTTCAAATCAGAACAATGGACCCAGATATTTACTCGGACCCGTTTAAAACGATTCAG
TATGCACTAAGTGCAGTGCACCCACCAGGTCTAGATGTCTTCCGAATCGATGCAACAACTGGCGCCTTGCTTGTGAATGGTCTCATCGACTTTGAGTCCG
TGCAGGCACATACACTGACGATCGAAGCTCGCGATTCGAGTGAAACCAACTCGCTAGTTATCACCAAGGACCTCACTATTACCGTGGTAAACGTTCAAGA
CACAACTGTGGATGTATTTGGGCTTATCGCTGATAGTTCTCGCAAATTAGACACAATTGGTGGCGAAAGGTTCTTACTGACGGGCACAAATATCGGATTC
AAGCAGCGTGCGGATAGTTCTGTGGCGATTAAGCAGCTCATTGTGAATTATGGGACGTATGGAATTGCTTCGCCTTATCTCGCGACAAACTGCTCCCTAG
TTAACGGAAACACAGGCGTCGAGTGCACGTCAGCTCCTGGTTTAGGCGCAAATCTCTACTGGAATATTACTTTGGTCATGAATGTTCCCAGTATTGGTGA
CATGACGTTCCAGGCATCATCCTCAGTTCCACTGACCTCGTATGGTTCTTCCGTTATTGACTCAGTCGTGTGCAATAGTGCATTCCCAACTAATGGCAGC
ACTGTGGGAAACATTTTAGTGTATGGAGAGAACCTGGGATCAACACTCTTGGCAAGCTCGGATGTGCCTATGGTTTTGTACGGCCCCGACTTTGAGGCAC
AAAACTGTAATTTAGTCGCATCTAGCAACAATTCTTCGCCTACCCGCCAATATCTTGCATGCCGTAGTGCTCTTGGCACCGGTCAAGAACTTCCCTTTAC
AGTGGTGGCTCGTGATCAGGCAAGCGCGACTTTCGCTACAAATTGTCGTTATGATTCCCCTATTGTCACTGCAATTTCTGCATCTAACGGAATGCAGACT
CGTGGAAGTAACACAATACTGGTAAATGGAACTGGATTTGGATGCCAGGGCTGTGCCAACGTCACAGTATGGTACACAAACGAGCTGCATTCAATTGAGT
TAGACGACTGCAAGGTTGTGGTTGATCATGTGCAGTTGGCTTGCTTGTCTCGGCCTGGAGCAGGAGGATTCTTCCGATGGCAGGTTTCCGTCGACAGTCA
GCAGAGTGCTCTGACTAGTGAAAGTTCGACCTCTTACGATTTACCTGAAGTTTGGGAAGTGATGGGCTTCAACGATGTCCCTACAGCAGGAGGAACAGTT
TTCCAGCTGCGTGGGCAAAACTTTGGTCCTGACACTGCTATTTTCGTGGATCCAGTCGTCGAGTATTCATTCGACAACGTGACTGTCCTTCGTGCTGTCA
ACTGCAAGCGAAAATACACTGATTCGACGAATCACAACTTGATTCAGTGTGTGTCCGCTGCTGGTAGTGGCTCGTTCCACTCGTGGCGTGTTACAATTGA
GGGTCAAACTTCGCACTGGACGACACAAAACACGTCCTACGCTGGGCCGATCGTGACAAAAGTATTCCGTCCGGATGGAGACACAGAAATCAAGACGAGT
GGTGATCAGCAGGTGGTCATAACAGGCAAGAACTTTGGCACCATGAACGAGTCAGTCATTACAGGAGTAACGTATGGTGTCAATGGGAACGAATTCACCG
CGAGGAATTGTACGATTGTGATCGACCACGAACGTATCCTCTGTACGACTGCGCCTGGAGTGGGCAATCGCTTAGCCTGGATAGTCACAATTGATAATTT
GGCTAGTGCGACTCCAACGATCAGTTATGCGAAGCCATATATCACCTCGATTGAAGGGGAGGGGGTAGTAAATGCCCTCGTTCGTGGTGGACAGAGTATG
ATACTTCGTGGTGGGAATTTTGGACCCAGTGACGTGGCAATTGGCAGGATTTCGTATGGTACGTCCGGACGAGATTACCAAGTGACGGAAGTGATCGAGC
ACAATGATTCCACAATTGTTTGCACGACTGGACCTGGTGTTGGGGCAAACCTTTCCTGGATTGTTTCAGTTGGTGAGCAAGAGTCAAGTTTGTCTACTGT
TACTAGTTCATACGCACCTCCTGTGGTGACATCATTTTACCCATCCGTAGCACTTAATGACGGTTCTACTCAAGTTACCATCGTTGGAGAAAATCTGGGG
GCAAATGTGACTTTTGCAGCATCACGTGTGATGTTCTCGCCACCTCAAACAAGTTTATCGAGTTACCGCATCCCAATAATTGCATTTGGAGATTTCGGCG
ACAGTAACAGCAGCGAATACGTAATTGTTCGGATCCCAGTGGGGTATGGTAGTGGAGCCACGTTGCAAATTTTGGTTGGCACGTCAAGTGTCCAGAAGAG
TGCTGCGGTGATGATTAGCTACGGTCCTCCTTCGGTCGATTCAGTGTTTACTGATGAAGGCCCCAGTGAGTGTCTGCCATCTTGCATACAACTGACAATT
ACGGGCTCTAACTTTTACACCACTGGCCGTgtgctggtgtcgaagtACCCTATCACCACAAACAACCTGGGAAGCGCAAGTTTCGAATCTTCAGTCAATT
TTTCATCGTGGTCTCACAATACCATTACGGTGCCAAAGTACGTCGGTCGGCTAGGATATGTGACCATAGTGGTTGGCAGAGAGAAACTGTTAAGCAATTC
TGCTTCGTTCAGCTGGGATGATCCGTCCATTCTGGACTGGAACACATACATGCCTACGTGTTTAGTACCAGCTTGCACAACGAGTTACAGATTGGATGGA
AACACGAATCGTTACCGCACAGTGGCGACTACACCAGGCGTACCCGATGTCTTTAACTACGAATCCGCTACAACTGGTGGAGCTACACTGACACTACATG
CAAAGTACATTGGTCGCAGTCCCCGAGTAACTGTTGGCGGCATCGACTGTACAAATGTTGTAGTGGGGACACCCGTCATACCAGCTAACATACTCCTATC
AGGGGAGTTAACGGGGGTGAACAATATTCGTGAAATTTCCTGCACTGTACCTAGTGGTCAAGGAATGATGCTTGAACTTCTGGTGGTTCGCGGCTCAACG
CTCAGCAGTCCGAGGTACTTGAGTTATATCCCGCCAAGTGTGAATTGGGCTGGAAGTTCTGCCACTTTTGCGCCTACAACTGGAAACGTGGTGACCCTCA
CAGGGACAAATTTCGGCACCACGCCAGTCATTTCAATGACGGGAAGCTCTAATCAAACTGTTTCGCTTAATATCGCAACGTACGATCACTCACATGCTAC
AGTCAATATTCCTCCAGGTGAAGGTCTGAATTTCACCATAAAACTGAGAGCTGGAAATCAAGAAGATACCACAACATTTAGCTACAAGGCGCCTGTAATT
CACAGCATCGAGATTGAAGACGCTACCACTGCCGGTGGATCTACGATGACTATTCATGGCCAGAATTTTGGGAGTAGCGTGCTTTCAAACGCCCACAACG
TTTCTATTGGTGACACATTTTCGTGCGCAATTGACAGCGTCGATCACGAATTGATTCTTTGCACAACTAGCGAGGGACAGGGGAGTGGTCATGAGGTTGT
TGTAACCGTGAGCGGACAAGTAAACGTGGATAGAACGAACTCATTTAGCTACGATCCTCCGGTTATCTACAGCATCAGTAGGAGCGATGGTCCAACCTCA
GGATATACTTGCAGCTGTACAGATCCAGATCAACCTTGTGCAACGCTTGAAGCACCTTTCGAATGCCGTTATCTTGAGGCAAGTTCCTCAAGCACTGCAG
TGGACAGTTATTGCGTGCAAACAGTGTTGAACGGGGCTTCACAACAGGTGACTGTCACTGCTGTGGAAGATGTATATTCCAGCAATAAGCCCGTGTATAC
TACGAGTGATACAGATACGGGTATTCAACTCCTGTACACAGGAGGATTCTGGCAATTGCTTCAAGACGATGAGAGCATTTATCGTGCTAGCACTGCCACT
GTGAACCCGTCACCTACAGGCTGGCTCGATGTTACGGTGAATCCGCCTGTTAGTCTTACGACAATGAAAGTCTATCTGGGGACTTGTTCAAAGGCGGCTT
CACGTGCTTGTCCGGCCGGTACAGAATTGTGTGAGCGTGTAGCCGTCACACTTGCGGGCAAGAACTTTGGAGTTCAATCGCTTGATTGGCATCTTGAGTT
GGTTAGCACTGATGAGTCGGTTGAAACAGTGAATGTCACCACTGATGACCTTGTATACTTCAGCCACTCGAACATCAAGTTTAACTTGCCGCCTGGACAA
GGAATTTCGCGGCTTGTCAACCTGACCGTTTCTGATCTTCCGCTTGTCAACAAGTCTATTGGATTTGGGTACCAAACTCCGGAAGTCATCGGATATGAGA
CCAGCACAAGTAACTTGTCAACTTGCGGCGGCTATACGATCACTCTCTACGGGAAAAACTTCGGATCAGCACGGGCCAAAGTTCTCATTGGGGGTCGTGA
TGCACGTGTTGATGGTCAAAGTTCTGACCCGAGAGCGTGTGGTCCTGAGACGTGTGAATACTCGACGAGTGGTCCCTGCATCGATATTGACACTTTAGTC
TGCTATCCTTCGGTGTATGCCGTAAGCCCTACTTTCAGCTTCCTCGACGTCTGTAACGACACTACGGGGACTCAAATATtgtgtgaagctgctgatcctG
CACCAAATCTGCCTGAAAATTTCTCAAGCCACTCTGATTTTATGATTGAAACTAAAGTTCCAGCTGGATATGGTGCCGATGTCGAGGTGTACGTAATTGT
TGACGGCCAAGCTAGCAATTCCTTGTCGTTTTCATACAATCAACCAGTCGTTACAGCTCAGATGCCGAATCAACCCGATGCAAATGGAGCAAACGCCATC
ACGATCAAGGGCGCTGACTTCGGTTGTTTTCCGAATGATGCTATCACCATTTCCTTCGTATCCACAGATACAGTGCAGCCCATTTCGCGAAAACTGAGTA
CAGCAAGCATCTCTGATGTCCCAACCTTCTCAAGCATAATTGAAGATGAATCTCGTCGACTGTTAGCTGACAATATAACGTCAACTAACTCAACAAACAG
TAGCGAGAACTCAACCGGTACCGTTGTCTGGACGAGCACGTCGGAATTGGTGTGGTATCCACCCAAGACGAAGGCTGGTATCACGAGCATTATTCTGTCG
GTAGGTGGCAACGTGATGTCTCCTACGAGCCAGACGCAGCTGAAGTTTCAATGTAGCCCAGGCTACTACCGAACTTCCACAGAGTTCTGCGACGAATGTC
CCGAGGGTGCTACTTGTGCTGGCGGGGAAGAGATACCGTTAGCGAAACCTGGTTACTGGCGTGAAGGTGAAGTTATCTTTGCCTGCGATCCGATGTACGC
GTGTCTGGGTGCCAACAAGTGTGCTGAAGGCTACACGGACATCAGATGCGGTGAATGTGAGACGAATTACCACAAGCTCAATTCCGAGTGCAACCTGTGC
CCTGCAAACAAGTGGGGGTCTGTCGCAATCGTGGTTATCTGCATCGGTGTAGCGTCCATAGTGAGCTATTTCTTGACGCGAAAGGGGGTGAGTCTCGGTT
TATTATCCATCGGCATTGACTACTTCCAGactctctccatcttcggTAATGCCCGCATCGCGTGGCCAACGTCACTGATTAACTTATTCGCAACTCTGTC
TGCTTTCAACCTCAATCTGGAGTTGATTGCACCTGAGTGTTTCTCCTTCCAAGTGTCGTATGTGAAAAAATGGTTTATCATCGAGTTGTTCCCGTTAGTT
ATGGCAGCCGCTGCGCTTGGGATTTTTGCTGCACTTTACGCTTACAAGCGCTTTATCAAGAGACGACGCACGCGACTAACGTCACATTTGCCTCAGCTGT
TCGGCTCAACGCTCGTGATGATGTATTATCTCTTTTTGTACCTCACACGAACAACTTTGGATGTTTTCAACTGCGTCGGGACGATACCGTCGGACGGGAA
GCTCTATATGGTGGCCATTTACACTCAGTGCTTCAAGCCAGGAGGAATTCATTTGCAGCTCTTCCCGTTCGCAGTACTGGCCTTTGTGGTATACTCGCTT
GGCTATCCGCTATTTGTGCTCCTTACGCTTTCTCGTAATCGAGCGCTGGTTATGGAGGACCAGCTTTTGAGGGCTATGCAGCGAGGGACGAGTCGACGGA
CTAATCCTAATTGTTGGGTGTTCCGCAAGAAGTTCTCCAAGCTTTACTATCAGTTCAAGCCCGACTATTGGTTCTGGATGATGCTCATTATCCTACGGAA
GTTCCTGTTGGCGGGTATCGGGCTGCTCTTCCGTCAAGACCCAGTGTTCCAATTGGCTACAGCGACATTCGTATTGTTTGTGAACTACGCGCTGCAAGTG
CGTTGTCGCCCATACATGAGCGCTTATGAGACTCAACGAGTGCTGGCCGACTATGCTAAGAGAGTTCTGTTGGAAACTCGCCGTGCTAAGGCTAAAGGAG
AGACGTACATTCAGCCAGCTCACCTTCGTCTCGAAATGCATGCATCCACAGTGACTGCCTGGAAGAGCGGCCATGGAGATCACGGAGGAAACGGCGTGGC
TGGAAGTTCCGCCCCACTGACGTCAGGTCTGCGTGGAGCTAACGAGGCCATACTTGCTTCACAGGAGCCACAAAACCTTGTCGGATATCTCTGGGACCAC
AACACAGTGGAAGCCTGTCTTCTGTTCAGTGCTTGCCTAGTTTTACTGGCAGGTGTGATGTTTGAAAGCGGCCGACTTGGGAGTAACGAAACCGGATTCA
CCAGCACTTCAGCCCAGATGCTGTCAATTGCTACAACGCTGCTCGTAGTTGCAAGTTGTGTGTACTTCGCGCTCGTTTTGATCACGGAACTTGTAGTTGC
GCTCCGGCCCGACTACTACAAACGCATCACTCGCGTGCAAAAGGTTTTCAGTCGTCTCCGACACCACCATCTGAAGGATGATGCCGAATCCGAACAAAGT
GACAAGCACCGCAGAGCTCTCCCggcaggcgacgacgatagcgacgacgatggtgatGATGAGCTCGAGATGGTTGCAACTATGACACAAAACCCACTGC
A