Description :
From Genome Similarity Track
Location :
scaffold_150:30225- 32081
Transcript NameFunction/comments
g11215.t1 hypothetical protein PHYSODRAFT_470337
g11216.t1 2OG-Fe(II) oxygenase superfamily protein

Sequence
1856 bases(100 bases per row)
GGCAGCGGACTTTGCGTTCTGTAGGCATTCGGCACGACGCGTCGCGAAGCAGTGTACATCCGAGCGGTGGCGAGAGCGATGTTTTCCGGTACACCCGTCA
TAAAAAAGTTACATTATTTTGTAGCCCTGCTCAATTTTCAAAATAGATTCGGATACGCATATACAGGTGTATACATGCGTCGGTGACAGTAGCTGCAAAT
CGGAGCTGAGTTCCGCCCAATCGCCCTCGCCATTTCCGCTGCGTCAATACTCAGACGCGTTGGTCTCTGCTGACCGCACATTGAACTGCTCGCCATGGCT
CATTCCAAAACGAGCGAGCTCAAGGTCAACATGGACGTACGCCAAGTGCCAGTCGTCGACATTGGAGCGCTCATGGCGTTCCCCAGTGACGCTGCAGTGG
ACGCCGCACTGCGCGACGCCAATAACCCAGCAATCCGCAAAACTATTGACGAAGTCCGCGCTGCTGCAACAGAGTGGGGGTTCTTCTACGTGGCCAACCA
CGCGCTGCCGGAGCAGGAGGTGGACCAGTTCCAGGCCGCCATGCGGTCCTTTTTCCAGTTGCCAATGGAGATCAAGCGCACGATTCGTCGTAGTGCCACC
AACTCCCGAGGGTATTTCGACGACGAGCTCACCAAGAACAAGACGGACTGGAAGGAGTGTCTCGACTTTGCTGGGGCCAATGAGGACGGCCCAGTGAATG
ACAAGCACGAACGGTTGGGACACGATCAAAACCAGTGGATCCAGGACAAGCACCTGCCCGGATTCCGCGACGAAATGTTCCAGTACTACCACCAGATGGA
GTACATTTCGCGCCGCCTGCTCAAGGTGTTCGCCGTTGCGTTGGGTGAGGAACCGGCGTTCTTTGACCAGTTCTTCCATGGTGACAACTCGAGTTTCTTG
AGATTAAACCACTACCCCGTTGCGCCAGAACCGGAGAAGACCATGGGTGTGAACCACCACACGGATGCTGGTGCGCTTACCATTTTGCTGCAGGACGATG
AAGTTGCGTCCTTGCAGGCGTTCCATCGCGAGTCGCAGACGTGGACGCTGGTGCCTCCGCGCAAGGGCACGTACACGATCAACATCGGCGACATGGTGCA
GGTGTGGTCCAACGACAAGTTCGTGGCGCCGCTGCACCGCGTGCTCGCCAACGGCGGCGCTGACCGATTCTCGGCGCCGTTCTTTTATAATCCGTCGTAC
AAGGCTCAGGTGAAGCCCATTGTGGTGAAGGAGGGTGAGGTGGCCAACTACCGTCCATTGAGCTGGCGTGAGTTCCGTCTGGCGCGCTTCCAGGGAGACT
ACGCCGACAGCGGCAAGGAAATTCAGATTGGCGACTTCAAGATCCATGGACAGATTGATGTAGCGAACTCGTAGCTCGAAGGTGAATAGTGGCATGCTGT
GAAAATGAAATCTTAGCAAAGGAGTCTCCGTGTCACCCTTCGTGTGCGACTAACTGAGCAGCTGGCACCTTCTTCCGAAGAACACTAGCGAATCAATCAC
TGCTGCATGCAGGGCGGCGTCAATGTTCGACTTCAGTCGTGCGAGGAGATCTCTTAGCTCATTCCTGAATTTGCCACGTCAAGCTCAAGCCCAAACCCGG
TCAAGATGAACGTGCGCCAAGTACCAGTCGTCGACATCGGAGCGCTCATGGCATTCCCAACTGATGCAAGCGTGGACGCTGCACTGAGCAATGCCAAGGA
GGACGCTTTGCGTCAGATTGTCGAAGAAGTGCGCGCTGCCGCCACTGAGTGGGGATTCTTCTACGTCACCAACCACAGCCTGCCTCAGCAAGAGCTAGAC
CAGTTCCAAGCTGCCATGCACTCCTTCTTCCGCCTACCAACAGAAACCAAACGCAC