Description :
From Genome Similarity Track
Location :
Scaffold_953:3022- 9684
Sequence
6662 bases(100 bases per row)
ATGCCCAGGATCATATCATAGGGATCCATATCGAGAACAGTGAACTGTTCGAGGCTGTCAAAGTCTTCAAACTTGACAGCTAGATCCACTTGGACGTTGG
GGACAGTGACGACCTTCCCGTCGACCAGTCGCACTGACACCGTCCCGTTGCCCTTGCTTTCTCTCAAAGCTTCGGACAACTTGTTGCTGTTACGAGCAAC
CGTCTGGCGGCGTGCGAAATTCTTCGACGCCCCAGAGTCAATCAAGATTCTAAAGGGATGATCGTATCCCCGTACACATCCGTGTACTACGAGCAACCCG
CCGCTGCTCTTCGCCGATTCGAGAGTGCGAAGACTCTCAGGGGCTAAGTCCCCGTGGTACGCGCCACCCGCGCACCCATCACGAAGACTTAGGTCTCCCC
CAGTAGGGCGCCCCGCCCCTACTGATTCCCAGCGTTCCCCTATCCCCGGGATCCTGGCTTCTGCCAGCGACCCTTGAGGACGGGCTTGGGGAAGGACCGT
CTGCGGAGTCTTTCCGCAGGACAGTCGCGCTTGAAGTGGGCCATCCTCCCGCAGCCGAAGCAGCGGATGTCACGCTGTTCGGCGGACCCGAGCTCCATGG
GAACTGGTCCGTGGGGCTTGTTCGATCGGGAGCCGACAAGGAACTCCCAGGCCACGCTGAGGCCGGCGTACGTGCCTGGCGATGGCTGTAATCTTCTTGA
AGAGCCACTTGAATCGCCCCTTCAAGGGTGCTTGACTGCACCCGGAACAGCTGAGTGCGTGCGGGGCCAACTCGAAGGCCGTCCATGAACACAGTCATCT
TGATGTGTTCGTTGAGTGGGTTTCCCACTAGGGACGCCGTGAGCTCCCGTATCTCTTGCACATACTCGTGCAGTTCGCGCCTTCTTGTTTACACGCGAGG
AAGCGCGAGCGCTGGCGGTACTTGTAGTTCGCCAAGAGGAACGCGGCTCGGAGCTGTTCGCACAGCTGAGCCCAGGATGTGAAACATCCAGAGGATGTTG
CTTCCCGTGTGTACACCCAACGCTTAGCACGGCCGCTAAGGTTGGAGAGTGCAAAAGCAACACGCAGTTGCTCGGTCGAGATCAGAGCCGCGTCCATCGC
GAGCTCTACTTCTCGGACCCAGAAGTGAAGGTTCTCGCCTTCCTTCCCTTCATACGGCTTAGCCTTCAGCCGTATTGGCTTCGGGTGAGGCGGATTTTCT
TCCGCCGCCGGAGCCTGCAGGTTCTCCCGCACATGCGCGATGAGGCCCTGCTCGTACGCGTCGAATGCATTGACGCGCTCGAGCTGCTCAGCCGGTGTTG
ATACCACCAGGCTCTGCAGGGCCTCCATCCCGAAGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGAGTTGACCAATGGCTGAGTGATTCGTGTGTATTTCTGGCTTCGCTACGCGTTGTCA
AAGAGGCAGAGCCACAAACCTGGCAAAATCCGAAATATGTTACGGTTGTTGACCCACTATATTTGCAGCTGTCAGATGTAGAGCGAAGGAATCAATACAT
CGACACAAGGGATCATAATTTCACGGAGATGCGCTCAAATCGCATCGTTTGCTGTCCAACGTACGTTGACATTGAATTTCCTCACTGGTGCGGCATCATT
TTTGACATGGAGCGCAAAATTGTGTGGAAGTATGATCCGCTCCACAAAAAATCGATTTTGGATGCAGTGCAAGAGGTTATAAGTGGCGTTTTCATGAAAT
TTATGAGCTCTCACATGGAGATGCAAGCTTTAACATTTACTGGATGGCGCCAATGTGATGGACACAGCTGTGGTGTATTGGTCGTGCAATGGTTGGAGCA
GTATTTGTCACTGGTGCGAAGCACACCTCCCGATGCAAGCATTCCACTTGCCCACGATGATAAACTGGATCCGAAGCAACTAGCATATGAGAGGTACAAG
CATTTCTCGTACGTATTGGATAGCGTAGTGACCAACGTCGATACTTAGCATAATTAAACCATCTTTAGTCTATGAGTGAGAAAGATCTTCAAATTCATCT
TGGGCTTATTAGTGGGTTTGAGGAGTGTGCTGCAAGTCACTTGTGTAGCTACATAATAGTAGAGAAAATTTTCTAAATACCACACAAGAACCGGTAGCGT
TTTAAGGCATACCGATTCACTCTCGTCTGCTCTATGCACAAAATATTGGTGAGCGTAGGGAGAGCCTTTACTATTTTCTTAAGTCCGAAAAAAACTGTAG
GTAAAAAAAACATAAAGAACACCAGCTCCAGTACTGCCGTGAAGCACCGGGCATCCGCAGCAATCAGTGAGCGTTGGAAGATAAGCATAACGCTAGGGCA
CGAATTTAGAAACGGGTAGCTACATTGAAAACGAGGTGCTAGAACAAACGTCACTGGTCAGCAAAAACACGACAGCAATTTTCACTATGACTTCCAAAAA
CTAGAGAGACGTCTGGATCCACATAAGCTTGTGCGCTATTCATTATCTTCGATAGAAATACGCTTATCTTCTGATCGAGAAATGTCATATTGATTTTCTA
ACAACCCACGTGAGAGTTTTGGGTAGCGCGAGTCGAATATAGGGGGAGATTCTACAGAATTATAAAACGTATTCATGGATACAACGCAGCCGGCAATATA
TCTAGAAAAGCTAAGGGCTGACTTTATAAACCCACTGTGTTCGATATTACTATTGTAAATGACCACTGGACAGTCAAGAATTGCCCGCTGCTGCTGATTC
TAGCTGTAGTGGTGGTGAGGAAGGGGGAGGGGGGGGGCGACGGACCCGCAACACTGCGCGTCATTACGGGAAGTAGAGCTCCAGAATGAACCTGAACTGA
ACTTGCCAAACTGGTTTTCTGGTTCTCGAGGGTTTTCAGATGAAGAAAACCGTCATACCAGCTTCGGAAGAATATACATTTGCGATCGAGAACCTTGTAT
TTGACACTTCATGCTCCGGTTGCTCCAGTTCATTCCAACTGAGTCCTCGCCAGTCATTTCATCAAAAGCAAATTTGAAGAGATTGGAGAATTAACACATT
CACATTCATATGGGCCATATGGGCTCTCAATAAGTACACATGCAGCACTGTTATATGTGCAACTTCAATGAGAGTTTCAAATGGTAAAAAAGGCGCTGTA
CGTGTACATTGTACGGTATAGTTTACACTTTACAATGCATACATTAAAAGTTAACACCTTGCGTCCGGACGGTACTTGCCCAGAACGCGTAAGCGCATGT
CGTAAGATACGGTAGATCAATGTTACTACGTATTTGTATGGGTGCACTTTTTGACGTGATGTTAGGTGCATTAATTTTCAACAGGTTTTTCTTTCAATGT
CGTAACTCTGACGGGATTCAGCGACAGTATTGCCTGCTCAATGTCGTAACTGACTGCAAGTGCAGTCAACAGATGGCTAAATTGCTTCACAGGCAGTCCA
CTTAAATCAAGAAACGCAAGGACGAAGGTACGATGGTTCAAGAAGCTGTGTATTTGAAACAAATCACTAATCAACTGACACGCAACCAAGCTCACTCGTC
ATCACTACCATTCTCGTTGTCACCACCGTTGCCGTCGTCGCTGCCAGCATCGTGCCCAAGTCTAAGTTCCCGTCGCGTCTTCTTTCTTTGGCCAGCTTTC
TGGCCGGGCCGACGGAGCACAATGCGCTTCCCTAAGTTTGGTGGGATAGCTTGCCCGGCGTCGAAGTCATCATGCCAGATATCATAGCATGTCTTCGCAA
CGCCCTTGTATTCCCGTCGAATACGGTTGCACAACCAGCATTTCGCATTATCAACGGAGCAGCGTTCGCAAAAGAACGTTGTTGCGAAGGACTTCTTCTT
TTCAGTACGCAAGAGCGCGCAGACCTTGCACGATCTCTGCCGGCGTTTCTGGACCCCAGTAACGGTAACCCAATCTTCAGACTGCTGCAGCGCGTGCGTG
AGGCGTACTGGGGTGCGCTGGCGCTTTTGGCTCGCAGGAGGCGGTGTTGCCTCCACTCCAGCAAAATCTTCGGCTTTGAGTTGGAGAAGTTGATTTTGAA
GGACGCAAAACCACTCTGAGCGCTTCATAGCAGCCATCCCCTTGATCTTGGCCCCCTCTTTGTGCGTAAGATACGCATTTACCATGACCATGTCCAGCAA
ACCTAAGAATAGGCTCTTATAATATTTCGTGAACCTCGTCGACATTTGCAGTGAATACGACTGGAGACGGAGTTGATCGTGGACATCAACTCCGCTCATC
CAGTTCTGGTAGTCATTTACAGCAGAGGGGCACGGCACTCGAACCGGTACAGCATCGACAACTTCGATGCCCCACGTGTCGTTGTCCCTAACGACCCCGA
TCTGCGCTCACGGATTATCCATGAGCTTCATGATGCCCGCTGGGCGCTCATCTCGGTCGCGA