Description :
From Genome Similarity Track
Location :
scaffold_38:30219- 33202
Transcript NameFunction/comments
g12657.t1hypothetical protein

Sequence
2983 bases(100 bases per row)
GGCATGTACCTCAACATGATGTACAACGCGTACTTCGAGAGACCAAACAGGATCATCACATCTGACGACGATATGCTGACGTACGCTCTGTCTGGCCTCG
TCATTGTGATCCTCCTGCTGTTGATTTGCTGCGGTTACATCGCCAGTCGCGTGACCAAGAAGATGTCGATGAAGCAACGCAAGCTGCGCAAGATCAAATT
CTTGTTGTCGTGCTGCTGCTTCTTTATCTCCATGCTGAGCCTCACGGTGTTGTCTATCGGCAACCTATTCACTATCTTCGTTCTGCTGTTCGTGGCGGTC
TACTGGTTCATGCAGATTTGCATCCTGCGGCTGCAATACCACCACATCGTGGTGCGTGCGCTGGCGCGCGCCTTCGACCGCGCAGTTGGCTGGATTGTGT
TTGGGCCCATTATGATCGTGTCGATGTTCCTGCCATTCATCTCCTCCTTCCAACAGCGTGTCATGTTCAACAACGCCTTCACCTCGGGTCTCGAGGTATC
GAAGCTCTTCGCGCACGACGTGGCACCGGCACAGGTTGTCAAGGTCAAGCGTGTTTCGAAGAAGAAGAAAAGCCGCGACGACTAAGCGAAACCATTTGCT
AGGACTTCTCTGTTGAGTTGATCGGTCAGCCAGTCTTGCTATTTTGTATCTTCATAGAAAACAAAACATTTTGTTCTCGACTGCTTTCAACGCGTCTTCT
GTTCTCTACATGAAATGCGAAGATTAGATAAGGGTGGCTAGTGATCAACTTCTTCTAACCTTGCATTCGGGTGAGGTCCGGGGTTGAAACAACATGACGC
ATGCCAACGAGCTCTGCAGCCGAACGACTGTTCATCCCACTGTGCGGACTCACGACATTCCTTTGGGCGAATGGAGCAAAGCTGCCCGACGCACTCAAAG
GAGATCGAGCGTTGTTGACGTGAGGTGGAGAGCCAATCTTGAGTTTGTCCAGAATCTCGGAAAACTTCTGTGTGTCCGGCTGGAAGCGCTTCAGATCCAA
TTTTCGCCGAGAGTCTCCTGCCCCATTCGTTTTCCGAGGACCTGAACTCGAACCACTCCCACTATACTTGAGCTCTATGGAAGACCGCGAGCGCACGGTG
GGCATCGTCAATTCTTGCGAAGGTGACGAAGTGTCGCTGCCAAAATCGTCATCTTCTCTAAAATCTCCAGATAGTGGCTCGGTATCACTTTCAAGAGATG
ACATCGTGTTACTCCTGCGGCGGGCTCCGTTTTCGTCTTCTTCGGCCGACAGACGCGAGCTTCGACTACCTGAGTCACTCTTTGGAGCAGCGGTTACCAC
GTTGGATGCACCAGCTGTCATCTCTCGCATGCGCATCACGTCAAACTCTTCGGCGTCAACTTCATTGTCAATTTCAATCGCCATTGCGCTTTCAGTATTT
CCTCGCGACATCTGGGTAGCCAGGCTCTGGATGGCATCTTCTATCGCGTGCATCCACTGCTCCTGACGCCCCCACGTGTCTGTAAGCACAATAAAATTCT
TGTATCCCTTTGACGAAAACTGCAACCCGTGTGCACCACTTCCGGGGCCTTCTGTCACGCCGAAGCTGTACCACTTGCGAACGGATGTGGGGATAACCCA
CTTCATACGGTTTGTCCAGTTGGCGCTTTGAAGCGTATCACAGTACCAGAGCTTATCGCATACTTGGCACAGCCCAAAGAATGTGATGGTAAACGTGAGG
GCATGGAATGGCATTGGCACTGGGAACTGGATAAATGAGCTCACACGCGTGGGTTCCGGTATAGGAATATGATCGTGAATCTTGTCCTTCTTGTACATGA
ATCCAGTGATGAACTCGTCCGTATACGTGACCTTGCAGTAGTGGCTTGCTGCGCCAGAGAAAATGGTCTCCAAATAGCCTGTGTATTCGTCCACATCTGC
ATTGGTGAGCGTGGCCGACACGTATTCGACTGCACTCTGCTTCAGCTTTAAACACCCATGACAGAGCGGCGCGTTACGCTCACCGAGCGGCAGCATCTCG
ACACGGTTCTGCTCGGCAAGAGTTTGCTCGAACTTTACCCACTTTTGGTGCTGTGATGTATACTGCCGCACGACATCTTGACACGTTATCGCAACTGATC
CGCTTCTGCAATTCGGGGTGCTGCAGCAATAGAAACGTTTTTGTTAGTGCACGCACGGGAATCTCAATATACCACACACAGTAGGTACGTACTTGGTCAG
TGTGAAGATACTGTTTGCAATAGTGGTCATGTGACCCTTGTACTGTACGTGCTCTTCGTATGCACGGATGACAAAATCCAAAATGTTAGCCCCTTCGATG
AAGAGGCTATTCAGCAAGGGCGACGAAGGCAACCGCTTTTGATCAGGATCCAACAAAACAAACCGAATGACGTCCGTAAGTTCGTGATGCAGCATGCTGT
TGCTGGGGTGCGATCCATAGCACGCCAGCAAGCATGGCATTAAACCAAAATTGGCCAAGAAGTAATCAACATCTCCACTTTGCAACAGAACGCAGCGCTT
GAGAAATGTGATAATGTGCAGAAGAGCAGACCCTTTGGTATTAACCGCCTTGATACTTCCTGGATTATAAGAAGTTGACATTGTGCGAAGCTCGTTGACG
TCCGACGTCACCACCGCTCGACACAGTTTCACAAATTTCTCCACGCGCGGGATTAAGGCACTCAGTACCGACACATAGACCGTTTTCAAAAGACCTTCGA
TACCTGTGACATCGCGCTTCTTCTTGTGATACCCCAATGTTCCCATCAGCATCATGACAATCGACAGAGAGCCACCTTCACGGACAACGAGAGACTTACA
CCCTTGAGTACACTGACGGCAAACCTCCGCAAACCCCAAATCAATCAGTGTACCAAACGAAACATCCGACGTATTGAGCAGAAAAATGAGCAGCGACTTG
AAAAGTTCGTTGTGATGGAGAGGGAAGTGCTGATCCGTGATCAATGGCAGGAAATGATCTGTGTTCTCAACAAAAGTGGCCAC