Description :
From Genome Similarity Track
Location :
Scaffold_327:3021- 4682
Transcript NameFunction/comments
Phyta_totarag7153G protein signaling regulator

Sequence
1661 bases(100 bases per row)
AAAAGACAAAGCCAGAAAGAGTTTCCTCTCTGCTGCGTGTGAAAGGGGCAGAAGCGGATGATGCAAGCAAGTTGCTTTATGAAAAATACGTCGAGTCTTT
CAACCACCTAACTTAGTGGACTAACTTAAAATATTAATCTCAAATCCCGCAAGTCATAAGAGCTTAAGCCACTCCAGCTCATTTTATTCTACCTTCTCGG
ACAGTAAGCTTAAAAGATCGGTTGATGCAGATGTGGTCCTTGTCAAGACAGTGAGtcaaagtacatgtaacgtttTAGTCACATGGATATCACCTACCAA
AGTTCCGCCATTTATAGCGGGCAGCATGCTAAATACACACATGAACCGGAAAAGTTCATGCAACTTGGCATTCCCTATCTATAGCGCTCTCGTCCAGCTA
AGTCTTGTCGCGTGCCGTAATTAGCTCGGGTCTAGCACGAGTGTTTCCCATTCGGCTCCACTACTTTCCACGGCAaagcgctggacgacaagCACTTACG
CGACTCTGCTTGGTGACTATCGGAAGCAATCGACATCCCATCGCTACCCGTTTGCTGCCATGGGAGCCGCTGCGTCCATGGACGACCCGGACGCGTCGGT
GATCTTCAAAGAGGTTCGTCTTTGAACGGTTCATCCCTCACACAAGTCTTCGTTTCTGCCTTCGCATCTTACTTTTTTATTTGTTGCAGACAAAGTATGA
GTACGaccgtcgtcttgctgctggtgactCGAAAGAGCAGATTTTCTGCAGCCTTCGAGATATCGTTGCGAACCGTTTAGCTGCAGAGGAGTCTCCTGCT
AAACCGCCACACGATGCATCGCAGCCAGTGGATGCAGCTCCGCCCCAAAAGACCGAAGATCGACCTACGAATGATTCTAAAGTTGAAAGTACTGCCGACT
CGCACCACGAGGTAAGCGCATGGTGAACCTGACCGTTGCTATTCTGTTGACTTGTAACTCACTTGGCCGCTCTCTTTTTGCTTTTTGAGCGCAGTCTCGT
GTATTAGGAGCAGAGCCACATACACGTTCAAGTTCACTGCTTGATGCAGCTACAATAGCCGCTGTGATCACAGCATCTGATAGCAAAGAGCCCAGTTTTG
AGCCCAACGTTGCTCAGTCGCCCAAGGCCGTACCAGACGAAGGCAATCGTCGTGAAGCCCCTCGTAATCCTTTCCACGACGAccatgaagctgaagacca
cGTAGATGAGGGGACAGCGAGTAGCATCCACCATGCCATTGGCGAAAAAGGCTTTGGACGAGCTGTTGGTTCCTCCCGAGCTGCGCTTGATTTAGTGCAA
AACCTGGCTCCCGTGTTCACAACCGACGTACTAACCGATCCAGCAACGCTCAAGATGATCCTCAAGTTCGCAGAAGTGAGCAAGGTACCCAACGGCGCGG
ACATGCTGCGATTCTGGGTCGAGattgacgagctgcagcaccttccgTCCCATTCGTACACGCACCGCCGTCTACATAAGATTTACGACAAGTTCCTCTC
ACCggaagcagcttcacctgTGTGCGTCACCGCACAAATGCTCCAGGACATTCAACACACCTTGGAAGGAGACAACATTTCTGCGGGCATCtacgctgca
gcacagcaaATTTGCTTTGTGGCGCTCGAGAAATCCGTGTATCCACGCTTCCGAGACAGTA