Description :
From Genome Similarity Track
Location :
Scaffold_156:30209- 33796
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_156-snap-gene-0.18Myosin
Pytap_DAOMBR444maker-pag1_scaffold_156-snap-gene-0.117 transmebrane protein Gpr8

Sequence
3587 bases(100 bases per row)
CGATGACTCGTCGCGACGAGAACGTCGAAGACGTAGACGGAGTAATCTTGGTCaCAGCCGGAGTCTTCGGCGCCGGCGAGAAGCCGTTCCCTTTCGTCAC
GTTCGCGCCATTGCCgCGGACCTGTGCGTTGAATGCTGAGAGTCCTGACGTCGAGCTCGAGGCCGTCGAGCCCGAGCtGCTGGCGCTGTTGAGGCTTGGC
ACCGTGCCGGTAGACGCGAGGAACGCGGCGAGCTTACTGTTGGtCGAGTCGGAGCGCGGCTTGGCCGCACTCGCGCTGGACGGCGGCTGCTTGGCCATGA
AGTCCCGCAGTTTGCTAGTGTCGCTACCGTTGCTGGTGCGTCGCATCGTGGGCGCGGGGgTGGGGgCAGGAGCCGGCGTGGGCGAGGGTGAGGgCGGAGC
CTgggACGGAGGTGGGGTCGTCGAAGGGCCCTTGGGCGAGAACACCGCCTTGCGCAGCGCGAAGCTGTTGTCCTGCGGCAGTaCAaTGCGCAGCGGCGGC
GGAGACTCTGCGCCCGAGTCTGACGCTGGATCAGTGCTCGAGGGCGGGTTCGCGCGCATGAACGCGGCGAACTTGTTGCGTGCGTCGTTGGCCGGGCCGC
CGGCTGGTGGCGCAACAGCCGGTGGGCTAGGCGACGACGCCATGACGTTAGGGGCTCGGTTCTCTTTGCGTGCGGTCGTCGAGGGGGCGCGTCGAGGCGG
ACCGGCGGGgCGTTGCACATGCTCCAGCGGCTTCTCATGCGATGGCGGCACTTGACTGAGGAACGCGTTGAGACGCGAGGAGCCGGTGCTGCTCGTGGAT
GTCGCAGTGTCGTTGTCGGACCGGCTGCGGCGCGCGAACGGTGACGACGGGACGTTCGGCGACATGGGCGGCGGCGTGCTGGGCGGCGTGCCGTCGGGTG
AGCGCGGCGATGgCGTCGGCGCCTTATTCTTCTTGCGGCTGAGGAAGCTCGACTTCATGAACGACGCGAGCTTGTTGTTCGACTTCTTCTTGACGGGCGC
CGCACTCTCCCCGGCGGACGAGCTCGAGCCCGTGGAGGTGTGACTATCCGAGTCCGAAaGCGGGCTCTCGGGTGCGAGGTCGAACGCACTCGGACCGCAG
AGGCTTGAAGCGCGGAGGCTCACGGCGTACTTGTCGTAAAGCACGGAGAGCGTCTGTACGACGGCCACGAAGTCGTTGGCGTCGATGAGATCGTCAGGCT
CAAACAGGTCCTGGTCTCGAAGGCCCTGCTTGCGGCACCAGTCCaGGAAGACACGCGCGTTGGCCTTGGAGTGGAAGACCGTCGTGAGCTTGTTgaCCTT
TAGATTGGCGCTGGGGTCAATGGCGTTGGCCAATAAGCAGAGCAGCTGCCCGTCCTGGAGCGCCACCGACAGGTGCTCTTCGCCCACAGGCTGCTCCGTG
ATCTGAGCAATCCAGTCCTGCAGCTCTTCGGCGCGGCGCATCATGGCGGAAGTGGAGCGAGCGATGCGCCTTCCTCCTTCTCTCGGGTGTTACGGTCTGT
CTGTCTGTCGGTCCGGAGGTCCGTCTCGTGCTGACCAGACCGATGCGAATGCAGCCGATGGCAACTCACGCACGCGCGCGGAACGCAGTGGCgaTCACTC
GACGGAAGGCGAGCGGAACGAGGAGCTCGCGACGCAGGACGCAGCGACGCGCAGGCCAGTGGGGGGATGCCGCCTTCCGAGGTAGAAGATGGCGGCGAGA
TGGCGGCGGGGCACTTCGCCGCACAAGCCAGGAAAGATGCCAACGCAGAGGAGCCCCAACCATCCCCAAGCCCTGGTAGAAAACAACGAGACAGCAAAGG
CCAGAGGCCCCACGAAGAGGCCAGCGCACGACCTAGCCCTAATAGACATCCAGAAGACCAATTGCCCCAGCCCTGGgAGGCAAAGGGACCAATCAGTGTG
AGGATGGGGGCGTTAGCCCGTCACATCGTCGCATTGTGACTTGACTGTGGCCCGGCtgACcATGAAaTGGGTTCACGGTGAACCTCACCACTTGCCCAAC
GCCGTCTCCCTTCGTTTGGGCTGTTGAAAAAaGCTCACTTTGTCAACGTCAGAGATGGATAACGTTGGGgCTTGTtGGACTTGCTCCTGTCCGCCCATTT
CGGCTCCGTTCCTTGTCGACCGATTCAGAACTTGCCTGGATGGAACATGAGACCAGATggcccccGACACCCTCTCGCGCACTCTTtCCCCcAGAGATCC
AGATGGTCTCATTCACCAAAGgTCTGCTGacgtcgtgacTGACGCTTTGGATGGGTgCACCGCCTGAGATTTCTGAATGTTGCGCGAAGGTACACGAGCA
ACCaGgCAaCaCGATACAAACCGATATCAAAACTGTTCCTAACAACTTCAACCTGCGATTTCTTTCGACGAAAGAATGGCGATCAGCTAGGGAAAGATAC
CCCGACCACTTGAgAaTCTCCCGACGACGGCCATGGCGTCGTGGAGCCTTCGACTTGTATCACTCGTGTGGGCGCTCCATGGAGCGACGGCGGCCGTGTA
TTCGGGCTTCACGGTTGGTCGCCAGTTCCAGTACCTCGGCAAGTTCTGCTTCACCTTCAAGCCCACGCTGCAAGAGCTCGCAGGGGTGCGTTGCTCAGTT
GATACTGGACAATGTGTGAGCGAGATGCTAATACGATGGGCGCGTAGACCATCACAGGCGAGATCCAGACGGATGTGGGAGATCTCCGGCTTGCCATTTA
CGACGACGAGGCGCTCTTCTGGAACTACATCATGTCGGATCCGAACTGTGGGTGCGAGTGCAAGATCTCGAATGCCCAcACCAAGGCAGTGTACAACATC
AGCGCCACGACGGATCTCTCCATCCCTTTcACGTTCGAGTTCTCAGTGCGTGAGCATCTGCGTCCGCGCTTTtGGTACGTCGCTCTCGCGCGATGTGTGC
CCGGTGGGgACTCGTACTCGCCGTCTTtCACCcAAaTCACcGAGGCCAATTACAAGAAGTACTACTTCTCGGCGTGGTACGACCTTCACATGACGCAGGC
GGACGGCTCGGAGCTTCCCGTTCAGCAGCAAGGGATGCCGCTGATGTACGGTGTGATGACCGTAGTTGCGGGTATTGCAGCGTTCGTACAAACTCTCGCA
GCACGGGGTCTACGACAGTCGGAAAGCTTCCATCCCATCATGAAGCTGCTCACaTTTGTCGTGTTTTGCTTCTTGCTGTCGAATGCATtATtGTtCTGCC
ATTTCTATGCGTACGAGTACAATGGCGTCGGCGTGCCtCTCTTTGAGTACTCAGCCAAGATCGCACAAGTATTTGTTCGCGTCGCGACGATGCTTTTGGC
CATGCTCATGGCGAAGGGATGGACGATCAACTCCATCACTCTTGATGGACAAGAGAAGCTCACGTGTATGATGATCaCGATCCTTGCGCTGTACTTGTCC
ATGGCGATGTGGTACCTGGTCTGGCTGGACCCGGcGTCAACACTCTACATTTACGACTCGTGGCCGGGTGTCGGCATCTGCGCCCTTCAGCTCGGTGTTT
TGGCCTGGTTCATGAACACACTCATGGAAACAaGGGCGTACGAAGAAGCCGCGAGCAAGCGACGCTTCTTCcTCCACATCGGTGCAC