Description :
From Genome Similarity Track
Location :
Scaffold_156:30204- 33795
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_156-snap-gene-0.18Myosin
Pytap_DAOMBR444maker-pag1_scaffold_156-snap-gene-0.117 transmebrane protein Gpr8

Sequence
3591 bases(100 bases per row)
GCGCTCGATGACTCGTCGCGACGAGAACGTCGAAGACGTAGACGGAGTAATCTTGGTCaCAGCCGGAGTCTTCGGCGCCGGCGAGAAGCCGTTCCCTTTC
GTCACGTTCGCGCCATTGCCgCGGACCTGTGCGTTGAATGCTGAGAGTCCTGACGTCGAGCTCGAGGCCGTCGAGCCCGAGCtGCTGGCGCTGTTGAGGC
TTGGCACCGTGCCGGTAGACGCGAGGAACGCGGCGAGCTTACTGTTGGtCGAGTCGGAGCGCGGCTTGGCCGCACTCGCGCTGGACGGCGGCTGCTTGGC
CATGAAGTCCCGCAGTTTGCTAGTGTCGCTACCGTTGCTGGTGCGTCGCATCGTGGGCGCGGGGgTGGGGgCAGGAGCCGGCGTGGGCGAGGGTGAGGgC
GGAGCCTgggACGGAGGTGGGGTCGTCGAAGGGCCCTTGGGCGAGAACACCGCCTTGCGCAGCGCGAAGCTGTTGTCCTGCGGCAGTaCAaTGCGCAGCG
GCGGCGGAGACTCTGCGCCCGAGTCTGACGCTGGATCAGTGCTCGAGGGCGGGTTCGCGCGCATGAACGCGGCGAACTTGTTGCGTGCGTCGTTGGCCGG
GCCGCCGGCTGGTGGCGCAACAGCCGGTGGGCTAGGCGACGACGCCATGACGTTAGGGGCTCGGTTCTCTTTGCGTGCGGTCGTCGAGGGGGCGCGTCGA
GGCGGACCGGCGGGgCGTTGCACATGCTCCAGCGGCTTCTCATGCGATGGCGGCACTTGACTGAGGAACGCGTTGAGACGCGAGGAGCCGGTGCTGCTCG
TGGATGTCGCAGTGTCGTTGTCGGACCGGCTGCGGCGCGCGAACGGTGACGACGGGACGTTCGGCGACATGGGCGGCGGCGTGCTGGGCGGCGTGCCGTC
GGGTGAGCGCGGCGATGgCGTCGGCGCCTTATTCTTCTTGCGGCTGAGGAAGCTCGACTTCATGAACGACGCGAGCTTGTTGTTCGACTTCTTCTTGACG
GGCGCCGCACTCTCCCCGGCGGACGAGCTCGAGCCCGTGGAGGTGTGACTATCCGAGTCCGAAaGCGGGCTCTCGGGTGCGAGGTCGAACGCACTCGGAC
CGCAGAGGCTTGAAGCGCGGAGGCTCACGGCGTACTTGTCGTAAAGCACGGAGAGCGTCTGTACGACGGCCACGAAGTCGTTGGCGTCGATGAGATCGTC
AGGCTCAAACAGGTCCTGGTCTCGAAGGCCCTGCTTGCGGCACCAGTCCaGGAAGACACGCGCGTTGGCCTTGGAGTGGAAGACCGTCGTGAGCTTGTTg
aCCTTTAGATTGGCGCTGGGGTCAATGGCGTTGGCCAATAAGCAGAGCAGCTGCCCGTCCTGGAGCGCCACCGACAGGTGCTCTTCGCCCACAGGCTGCT
CCGTGATCTGAGCAATCCAGTCCTGCAGCTCTTCGGCGCGGCGCATCATGGCGGAAGTGGAGCGAGCGATGCGCCTTCCTCCTTCTCTCGGGTGTTACGG
TCTGTCTGTCTGTCGGTCCGGAGGTCCGTCTCGTGCTGACCAGACCGATGCGAATGCAGCCGATGGCAACTCACGCACGCGCGCGGAACGCAGTGGCgaT
CACTCGACGGAAGGCGAGCGGAACGAGGAGCTCGCGACGCAGGACGCAGCGACGCGCAGGCCAGTGGGGGGATGCCGCCTTCCGAGGTAGAAGATGGCGG
CGAGATGGCGGCGGGGCACTTCGCCGCACAAGCCAGGAAAGATGCCAACGCAGAGGAGCCCCAACCATCCCCAAGCCCTGGTAGAAAACAACGAGACAGC
AAAGGCCAGAGGCCCCACGAAGAGGCCAGCGCACGACCTAGCCCTAATAGACATCCAGAAGACCAATTGCCCCAGCCCTGGgAGGCAAAGGGACCAATCA
GTGTGAGGATGGGGGCGTTAGCCCGTCACATCGTCGCATTGTGACTTGACTGTGGCCCGGCtgACcATGAAaTGGGTTCACGGTGAACCTCACCACTTGC
CCAACGCCGTCTCCCTTCGTTTGGGCTGTTGAAAAAaGCTCACTTTGTCAACGTCAGAGATGGATAACGTTGGGgCTTGTtGGACTTGCTCCTGTCCGCC
CATTTCGGCTCCGTTCCTTGTCGACCGATTCAGAACTTGCCTGGATGGAACATGAGACCAGATggcccccGACACCCTCTCGCGCACTCTTtCCCCcAGA
GATCCAGATGGTCTCATTCACCAAAGgTCTGCTGacgtcgtgacTGACGCTTTGGATGGGTgCACCGCCTGAGATTTCTGAATGTTGCGCGAAGGTACAC
GAGCAACCaGgCAaCaCGATACAAACCGATATCAAAACTGTTCCTAACAACTTCAACCTGCGATTTCTTTCGACGAAAGAATGGCGATCAGCTAGGGAAA
GATACCCCGACCACTTGAgAaTCTCCCGACGACGGCCATGGCGTCGTGGAGCCTTCGACTTGTATCACTCGTGTGGGCGCTCCATGGAGCGACGGCGGCC
GTGTATTCGGGCTTCACGGTTGGTCGCCAGTTCCAGTACCTCGGCAAGTTCTGCTTCACCTTCAAGCCCACGCTGCAAGAGCTCGCAGGGGTGCGTTGCT
CAGTTGATACTGGACAATGTGTGAGCGAGATGCTAATACGATGGGCGCGTAGACCATCACAGGCGAGATCCAGACGGATGTGGGAGATCTCCGGCTTGCC
ATTTACGACGACGAGGCGCTCTTCTGGAACTACATCATGTCGGATCCGAACTGTGGGTGCGAGTGCAAGATCTCGAATGCCCAcACCAAGGCAGTGTACA
ACATCAGCGCCACGACGGATCTCTCCATCCCTTTcACGTTCGAGTTCTCAGTGCGTGAGCATCTGCGTCCGCGCTTTtGGTACGTCGCTCTCGCGCGATG
TGTGCCCGGTGGGgACTCGTACTCGCCGTCTTtCACCcAAaTCACcGAGGCCAATTACAAGAAGTACTACTTCTCGGCGTGGTACGACCTTCACATGACG
CAGGCGGACGGCTCGGAGCTTCCCGTTCAGCAGCAAGGGATGCCGCTGATGTACGGTGTGATGACCGTAGTTGCGGGTATTGCAGCGTTCGTACAAACTC
TCGCAGCACGGGGTCTACGACAGTCGGAAAGCTTCCATCCCATCATGAAGCTGCTCACaTTTGTCGTGTTTTGCTTCTTGCTGTCGAATGCATtATtGTt
CTGCCATTTCTATGCGTACGAGTACAATGGCGTCGGCGTGCCtCTCTTTGAGTACTCAGCCAAGATCGCACAAGTATTTGTTCGCGTCGCGACGATGCTT
TTGGCCATGCTCATGGCGAAGGGATGGACGATCAACTCCATCACTCTTGATGGACAAGAGAAGCTCACGTGTATGATGATCaCGATCCTTGCGCTGTACT
TGTCCATGGCGATGTGGTACCTGGTCTGGCTGGACCCGGcGTCAACACTCTACATTTACGACTCGTGGCCGGGTGTCGGCATCTGCGCCCTTCAGCTCGG
TGTTTTGGCCTGGTTCATGAACACACTCATGGAAACAaGGGCGTACGAAGAAGCCGCGAGCAAGCGACGCTTCTTCcTCCACATCGGTGCA