Description :
From Genome Similarity Track
Location :
Scaffold_245:302- 5187
Transcript NameFunction/comments
Phyag_g3900hypothetical protein PHYSODRAFT_285441
Phyag_g3901conserved hypothetical protein

Sequence
4885 bases(100 bases per row)
cagtcACTGACCTTTGCGggttagcgtgtgttgttggtgggaactcacccgacacgtgagaatttattgtgaatcctacacgacaaCCCCCTCGCACGCG
GCGGGGCGTCCTGAGGCGGTGCCGTTTGGCAGCGAGCTGATCACGTTTATGAAGGACGCTCGTCGCGACTGCGAGGTGCTGACGGCCAAGACCATGGCAT
GCTTCGTCAGGGACCAGTACCTAGAGTGGCTCGAGGGCCACATGGTGGGCAAAAAGGACGCTGCCACTGCGTACGAGTCGCTGCTCAGACTTCTCAGGCG
CTTCGCGTATCGTCACGGGTTCGTACAGTGACCACCAAGCGGTTTCAATGTAATGTGCTCTTAAAATGTCTAGATGGCACTAAACTGTAGTTTGTGCCGT
TAAAGCGTAAGATGTGGTCTTAAAGTGTCTGTTGACGCTGTTAATATGTAAATTTTGCTCTTGTGCTTGTATAGGAGAAATTTTCGGATCTTGTTGCGGT
TCGAGGTGAATTTGCTAAAGCGTTTAAGACAAAGTACATTGGATACGAGGCTAGCACAGTGCTCAGCACAGATTAAACGGGAATCTACTTTGACATGCCA
CCGTCAAAAGTGCTTTCGGAGAAGGGTAAGCCAGCATCAATCACTGCTGAGCAGAAGCGCTCCGCCAGGCTAACTGCAGTCTGCACGGTGTGTGCTGACG
ACAGAAAATTGCTTTTACTTTTCATTGTTCGAGGCGAGCCAGGGGGCTCTATTGAGTAAAGCGAGCTCCCGACCTACCCAAAAGGTACACTTTTTACAGA
TTTTGAAAATTTAATGTATTTATTTAACTTTTTTTATTGTTGGTACTGTGCTACAGGCCACGTTTATACGGTTCAGAAGAAGGCTTAGATGGATGGTCTT
GTTTGGCTGTTCTATCTAAGGTCCTTGCTGTATTCGCATATTTCTGAGCCCTCTGTTCTGCTCGTTGACAACCTCGATTGCCATGTCTCTGAGGAATCGG
TAGAGGTCTTGGCCGACGAAATGCTGACCCACCTTCAGCAACTGCCCAAGAATTCGACGTCAGTCTGCCAACCTCTCGACGTTGGCATCATGGGCCCTTT
AATGGCCAAACTGAAGGAGTTGTGGATGGAAGAAAGACCATCACCACTAAAGGAAGGTGAAAAACGAGAAAAAAGGCTGCAAAACAGAAGCGGTTGGAAA
CCATCAATCGAGCCATCAAGGCGTGGGAGTCGATCGATTCGACAACGGTTACCAAAGAGTTCACCAAAGCGCTTCACACTAACTTTTAGCAAAATATAGC
TGCCTCCTTATCTTGCTTCAAATCGTATATCATTTTTAGGGTTCACAGTTCTTTGAGTTAAAATTTAAACCAATAGGATTCTATCTTTTTTTATATTTAT
TCAACCAAGCCTGGCAGTTGCATTCTGTCCGTTGCTGTAACCAAAATCGGAACATGCGTTTTTGCGAGTGGTACACTGTGCCGGTGCCCGCAACAGGAAT
ACCCTCAACTAGTCATCGAGAGTACCAACATTTGGCAGCAGACGAAAGGGCGTAGGGGGATGGGCGCAAAAGATCCTCGCGCCGTTTCCGTCGAAAAAAA
CTCCGTTTCTAAGCGTTTTTCTAAAAGGTGCAAGCTTGATCGCCCATGGACTTCATTCCCCAGATTTCCTCCGAGCGCCAACTTTAGCTTCGCCGCcagc
aagacgatggagatggagctgccggcCACGCCCACGCCCGCCAACTCGAGGGGCATGCACCTCAACTTCCAGTCGCCCACAGCCGACAAggcgcagcagt
cgctgcgGATGCAAGTGGCCGCCCacaacttcaagaagcgcacgGCCTGCGACTCGCCCGTGGCCTCGGACGGCTCGGCGTCGCCTCTGCCCGTGTCCAC
GTGCAACTTCTCGGCGCTGAGCCGCCACTTCCACCTGCCGCTCAAAGTGGCGGCCGAGAAGTTCGGCGTGCGCGCTACGGCCTTCAAGAAGCGGTGCCGA
GCCATCGGTATCCGCCACTGGCCCTACCGCAAAGTGCGCAGCCTTaagcgctcgctgcaggaactggatcagtgccagcagcaggcgcaAGACGGCTCAG
GTCCGCCACTCACGGacaagcagctccgacaatTCGCAGGATACCAGAGCCAACTCAAGCGGCTCCTGTCGCCCGAGACGTACGGCATCGACCCCTTGGG
CCAGATGCTGCCCGCCCACTTCTTCCAAGGCGACGCCGACGGAAGTAACACACCCGACGACcacgactcggacgaggactCATGTGGCTCGCAGAGTCCG
CGACCGGGGCTCGAGCACTTTACACACAGAAATAAGGCGCGCAAACATCTCTTCACGGACTCGCCGTCCTCGGCTTCCTCTCCTCACCGCGACAACATGT
TCTTCGGCAACCCCTTGGCCATGAGCGGTGCAACGGAATACAGCAGTCGAGCTCAGTTCAACCACTACAACAGCCAGGCCGGGATGATCCAGGCCCAGGC
GGGATTCGTCTTCGACACGTTATACGACCCCTTCGGCGAgctcagcacctccaccatggACCCGTACGGTGAAAACGACCACCCGTCGTGTGGCTACTCG
CTAGACGCCGTCTCGTACGACTTCTTCCCACTGCAGCCGTCGCCCACCATGGCCATGCGGAAAGCTACCGCCGTAGTGCAGCAGACTGCGACAGCAAGCA
CATCCAACTTGGAAGAATCCTCCACCTCGATAACCTCCAGTGGAATCGAAGGGCTGGAGGACGACATCTTCCGCCACATCTCCCCCGAATACGGTTGCCT
TGTgtagacagcagcagacggcaACCTCTTACTCGGATAGATGTGTCGATGTCGCTTTGTCCACTCCCCGGGCTCCTTCTTTTTGCTTGCATCTTCATTT
GAGCCTCTAAATTATTCCGATATCAATAAAAAACGACTTTGCATCTACTGGCATCTCTCCgagcactgctgctgccgtcgtgCATGCAATAAAAGCAGAG
TAAAGTCGGCCACTTGCCGATATGCCACAGCTACAGCATCGGCGCTCTCGACAGTGAACAAGTTCGGCCTCATGATAATTGCTGTTGCACAAGGGAAGGG
TGCAGGTTAGACAGCAGGTTGAAGCTGAGGCGTCAGTGAAAAGGACCGTGACAAACCCAAGCTCTTGGTGGtcatcttgttcttctgctcgtccttgacg
aCTTCATTCAGCAGATCTAGCAGCCAAAGCGCTACGCTTCGATAGAGCGGCGGCAAGGATTCCAGGGGTACTAGCACTTTCTTCGGTTCTGGATCCTAAA
AACACCACAACGAATACAGTTTGTCTAGGTCATGAGAGTCGCCGGAACGCCCTGTAGTCGCAAGGATTTTGCCACCAGCGGCAGCCGATGCCGAGGATGC
CATTCACGACGACCGTACCAAACTCCAGGACCCATACCACGATCCGGAAGTGCACCGCGGAGGTGTTCTGGTCGAATTCAGTGCAAATGTGGACTTGGGC
CTAGGCACCGCACGATATTGCCTGCCAGACGCAATGGGGCTGAATTCGGTGGCTACACTCCACTCCAACTCGTacagctgcaggagcaacaATTTCTGCA
CTGGGCTCCGCTGGCGAGTCGATTGCGGGATCCTGTCGATGTcgatgcactgcagcaatggtCGTAAACAGCACCACCTCACTTGGCATCGCGAAACATG
AACAGAGCAATGAGTGGAGCCAACTTGCAGGTGCGCACAGCGCAGTGTAGATCAAGATTCACCTCGTGTCGACCGTCTCTGCAGAGCTGTCTCTAGCTAC
GCCGAGACACCCAACTAgacgcttctccagcagcgccaacgctTCTTCAAACGAAATTCACTGCCCGGCTTTTAATCAGAGCGTTGGGGCGGAACATCGT
CTGCAACCGGACGGAACTGGCGCCTCAATAAACGAGATCCCCTGAACGCTACGAGAACGAAAAGAATTCCGCACAACGTTGCTATCCACTTAGGTCTATG
TGGTGCCTACCGACACTCGGGCGCCGTTGCTAAGACTCCTCGTCATCCTTCTCGCGGTCTTCGATTTCGCTCAGCATGAGCTGGTACTTGGTCACCACGC
GCTGCAACGCGCGATTGGCCGCGATAGTCGGCAGGATATGTGACTTCAACACGTCCCGTTTAACGTGGTCCTGTTGGCAAAGAGGAGTAAGTCACTCGCA
ACAATAATACGCGTTGGTGATTGGTAGCGAAATTTAATCACGCACCAGAACCATCGGACTCCACTCGCCAGAGTTCTTGCCATCGACTGCACTTGGGGTT
GACGGTCTGCAGCAAAAAATACTTAGGGAATACAGCCATAATttggcagcaacagaaagcagcaacagaaacGTACGCGTGGAAGGGGCCCATCATTTCA
GCGCACAGGTCATCCAGTCGAGCTACGTCCTCATCATGCGTCAGGAACCGCGCATACGCTTGCATCCTGTTGGCCGCGCATTTCAGAATTCATCAGCATT
AATTAAGGTTTTGATCATGTTGCGATGTTCGGGCGTACCAATAACGATACTCGGCCGAGCTTTTGAGAATGACCGCAGAGGCGACTTGATGTTCGAGGTG
CGATCGCGTCACGTTGCGCTGCATCAGCGGGTCTGACATCCCGGAGAGCATGGCCGAAGCGATTCCCCTCTGCGTCCGACCGTAGCCGGACGCGTTTTGT
AGTCGCCGTAGTGGTCCAAGCTGGTGTACACAAAAGCCCATCAAAATGTTAGCTCCCGGTAAGCATAACCAATCGGATGCAAACATACGGGAACACTCTT
CACTGCCACTGCATCCGTCGGGAGAGCAGACGCAAAGTCCGAGAACACAAAGCTGTCGTCTGCCACTCGCATCCTGGGTTGCATG