Description :
From Genome Similarity Track
Location :
Scaffold_1309:302- 3859
Transcript NameFunction/comments
Phyag_g10240hypothetical protein PHYSODRAFT_309438
Phyag_g10241hypothetical protein PHYSODRAFT_472762
Phyag_g10242hypothetical protein PHYSODRAFT_466642

Sequence
3557 bases(100 bases per row)
TGAAGCGCTAGCAGGTCCTGGCTAATCTCTGCCCCATCGAAATCCATCATCAAGCGATAGTCAATGCGGCCAACACATTCTCTTGGCtcagttgctgctt
gacgatCACCAGGCCGCCAAAATGGAGCATATCAGTGAGGACAGCCGTGAGCTATACAGATTGGCGTTGGCGGATAATGCTGCTGAGTTGCTTCGGAAGG
ATGCCCCTACGCCAGGACTGATGCACaggctgctgcaagaagaggatGCACGATTGGCCGACGACGttgcgatggaggagacaaGGATCTGTGTGACGGA
TGAGGTATCGAAGTATCTGGCCGAGCACCAACAACGCAAGACGAATATAACGGACCCGTTCCAGTGGTGGAGAGACAATCGCAAGCGCTATCCGCTCCTG
TCTCCTCTTGCCCGGGTCTGGCTCGGAACTGTGGGGTGCTCCTCTGCTGCCATCGGACCACTTCGACGTAAAATTCCATTCGAGGTGACTATTGACAACG
AGAAGTACGAAGAAAGCGAAGACATGTGGGAGACCATGATCAACATGATCTGCCTGCACGTGAGTATACGCAAACCCAAGAAGACCTCAGAGTaaggtgg
tcaagttgaagctggcagtCTAGGGACTATTTTTTAGTCCGTGTTTCTCAGTTTATACATGCACATTTCCTCATATTTTAGTGGAGACCATGCGCTGCCA
CTACGAGGTGCTGGCTGTTGCGCGTGATGCGTCGGCggtggagatcaagaaggctTTTCGACTGCAGGCATTGAAATGGCATCCGgacaagcaccagcag
aacGGAATTTCGAGTGAAGAGGccacgcagcagttccagacCATTCAAAACGCCTATGAAGTACTGAGCGACCCGCACGAGAAGAAATGGTACGACGAGC
ATCGCGAGCAGATTCTGCGCGGTGGAGACAGCAAcgaaggcgatgaagacgaggacgacctTAATTTGTTTCGGTACTTCAGTGCGTCGGTCTATTCGGG
CTTTGGCACGGACGACAAGAGCTTCTATTCTGTCTATGGAGATCTGTTCACCAAGGTGGGCGAATGTAGTTTATTGCAATGGTTTTTTGCTGTGTCATTG
CAGTGCTAATCgtttttgtgtgtgtgtgtgtggacAGATTGATGAACTAGATTTggaaggtggcgatggctCGGCGTCAGAAGTTGCGCCGGAGTTCGGA
CATGCTAAAACGTCGATGGACGATGTCAACTACTTCTATCAGCACTGGAAGAGCTACACTACTCAACGCAGTTTCGCGTGGGTGGACGAGTACAAGACGA
CTGATGCACCGACAAGACTGGTGAGAagagcgatggagaaggagaacaagaagttgcgcgatgctgccaagaaggcgTTTACAACTGAAGTGCGTGAACT
TGTGGATTTCGTATGTCGCCGCGACCCCCGAGTGCGGGCGTTCCAGAAACAaaaggagcaggagaaggagaaacgACGtgttgaggaggaggccaagaaa
cGTGAGAAGCAGGCAGCGTATGATGCCGAGCGACGCGCGTTTCAGGAgcaacaggagaagctcTGGGCTGACAGTAACATGGAGACTAGCCGCGTTGCTG
ACAGAGACATTGAGTTGGAACTCGAGAAGCTCCGAAAGAAAATGGATGCCGACGTGCTAGTGTGTGACTTGTGCAGTAAGACCTTCAAGTCTACGAAACA
GTTGCACAACCATCtcacgtcgaagaagcatcgagagaaagaagaagaacttggcGTATTCAGTGACCTCAGCATTTTGGACGATGAATTGGACAGAGCT
TTACAGGAAGAGCTTATCGCTTTGGGTAAGATCAAGCGCGAAGTTGATGAAGTACCTGTTGCAGAAGACAAGCCGAGTGATTtagaagaagaggacgacg
ctgagcagcaagaagcagatgcagaaACTGCACGTAtgaaggaggaagctgagCGCGTACGACTTGAaaaggagcagaaggcggcCGAGAAGCGCCGGGA
GCGCAAGGAGATGCGCAAGAAcaaaaagaaggagaatgTTGAGAAGATCGTGAACAATGCGCGATCGAAAAAGGAGAaaaaagaggaggaggaagagcag
cgcgGTCGCGGTAAGAagggcgacaagaagcggaGATAGAATATGATCTCATCAAAATACCAGGATCTTCATAGAAGTACTGCTAAGCGGCTTACATTAC
AATGCTTTGTTATGCGGACTGACTTTTTAAAGCTGTTGCGCAGCCTTCGCATACAGGCATCCATTTGGACGCAGCACACTTCGTTACTGCCGGTGCTGTG
TTGCAGTTGGAGCAAAAAATCACAACTTCTTCCGCACATTCTGCGGCAGCCTTCGAGGACGACGTTTGTTCCTCGTTAGATGGTTTGTCGTGTGTGCGCA
TTTGGTTGAGTTCACGTTCTTCTTTCCAACGCGAGACCCGAGCGCGTTGCTCCTCTCGCCGCTGCAAGTcaagtttcttcttcagagcAAGATCACGCTG
AACACGTTCGTCGAGAATGTCAAACCCGTTGTGAACCTGATCAAAGAGCCACTGAAGGCCAGCTTCCAGACGATCGTCTATAGCACCATTGTGGACTGCT
GGCTTAGCAACACAGGGAACGATCTTCGAGCTGGGGAATTTGTTCAAGCGTAGCAAGTTTTGCATCTCCAGTTCTGCTACTGCGTCAACATGGTCTCGTT
TATTGGCAAAACTATACAACACACACGGCAATCGGTGAGGCATGGATTTACAAAGAAAAACATTAGATTGAGCCGACACGTACATTAGTAGCGGTTTGTT
GATCATGACCTCATTAGCCATCGATTCTTCCAGTACGTTGGCAGCCTGAAGCACCGAGTTCTCGCTTGAGGAATCGACTACAAAGATAACACCATGCGCC
TGGATAGCACAACATTTGACTGTTAGCATCACGACAATGGACTGAATAGCAAATATCTGCTTACGTCGGCGTAGTACTCCGTCCAGACGTTGCGGAATGC
TGGGCCACCTCCAAGGTCGTAAAATGTAGCGGATCCTGTGTCGGTTTGGAACTTGGCAGATGTAAATCCTGCACTTGGCACATGTTCCTTGTCCAGATCG
CCCTGCAGGGTGGAAAGCAATGTCGTCTTCCCCGCTCCGTCGATACCAATAATCAGAAGTACGATCTCCATTGCGCGTGTGATCTTCGGCTTTTCCTGAT
TGCCTTCACCTTCTGCATTATTTGTTGCGTCTCCGGTTGGATGCAATTTCAGGCACATGGAGTGAACATTGCTCTCTGTCTTTCCGTCATCGTACGAGAC
GGTGAAGCTACCATTGTCATCGACAGCAGTGATAACGCCAGGGAAAAACCTTGGGCGACCCTTGTATCGACATAAGACGCGGTCATTCACATGAAAATTA
ACCTCGGCTTCAAGTTGGTTTGACGTTTCTCCGATAATGATGCGTGCAGCAACCACGTCTTTGATGAAAGCTTCGTGCATAAAAGCAGATATAAACGTTA
GCTTTTGAGTGATACATATACCCATGAATACCAGAACATCTTCCAAGCTCACATTTG