Description :
From Genome Similarity Track
Location :
Scaffold_1091:3019- 6243
Sequence
3224 bases(100 bases per row)
AGATCTAGGGCTACGTTGAGCTATCGGCCGCAGGCTAACGGCCAGCAGAAACGCTCGGTCGAGACCGTAATGCAATCGGTGCGAGTGTACGCGGAGGACC
CGCTGCAACAAGACTGGGATGAGATTGTGGAGAAGTTGATCTTTGCGCTTAACAACTCGCAGGACGCCACGAGGAAGGACACACCCTTTTACTTGGTGCA
CGGATGGGACGCAAGGTCCACCCTCCGAGCAATGTCCTCATCACTGAAGCGAGGTGTCGGGCGACAGTCCGATGCATTGGTGTGGCGCCGAGAGGTCAAC
AGGCAACAGGAGGTTGCGTTGGAAATGGCTAAAGAGTACCAAGCAGTCGAGAAAGCTCGGCGTGCCCAAAAGCATAACGAGGCTTTGAGCCGAGCGGAAC
GTGCTGCGCTTCCACCTTCCGCGACTGGTGAAACCTCGGAAGGTGATCCGACAGGTGCAGAGGGTGAGGGTGACTCACCAGACCCCGCACCGAAGTCTCT
CTTCCAGCCTGGTGATCGTGCGTGGCTTTACATGGAACGCGTCAAGCCCGGGTTGACCAAGAAGTTGGCCCATCGATGGCATGGTCCCTTCCGCATCAAA
CAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNAGCACTGAGCGAGCCGTCCGAGAGTTCAAGGTGAAGTGGGTTGGCTACGACGAACCCTCGTGGGAGCCCGCGTCGA
ATCTGTCTTGTGGCGGACTGCTGTATGACTATCTACGCGAGAAACGACGTGACCGAAGGTTGCAAATGGTCCAAGTCGCTGACGAGGACTAGTTGCACCC
CTCTCACAATGATGAACTGCCGGCAGGGCTACGCAGCCTGCCCCAGCAGACGAAACATGTTACTGCGGAAAGAAGATTGTATATTTGTTTGTTGAAGTGG
ACAAGACTTTACGAAGTGGAGATCACGACTGGAGAAACTATGGAGAACAGCTGAAGAAGGACAAACGACTACTGAATTGCATGGGCGAGCTAGTTACACT
ACGAACGAACTGTCTGAATACCCTGATCTAGCTCGACCTAAACATGAAGGAACGATGGAGAACTGGAACGAGGCTTAGGCGTCCGAAGACGAGGCAACCT
TGGCCAAAAACGCGGAGACGCGCAGCCGGAGAAACTTCGGCTTGCGCGGCAGATTGATCAGCAGCACTTGGAGGCGAACGTGGCGCGTCAGCCGGAGTCT
CGCTGGCTGGGGCCTCCTCAACAGGGGCCTCCGAAGCCGCGACGCGATCTTGAACCGAGTCCTGCGTTGCTGTTGCTGCATTATGAGCTCCTAGCGCTTG
TGTAGCTTCGCCCGAAATTTCTTGAGCATCCACGGCGCGGCGAGATTCGTCCTGAACCTCTTCCGAAGACTCTTCAGCAACCGGAGACTCGATCTCTTCG
ATCAGCTCCTCGACCTCCTCCTCTTCCGAGATTTCGTCTTCACCCGGCTGCCCGTCCTCCTGCAGACCGAAAGGAGACCCGTGAAAGTTCGTGAATTCAC
GCACCCACGGAGCCGTAGCACGGCGAGGGTCCAGCACTGGGTTGACCGTAATAGCTGTCGCGACTTCACGAACAGTCATGCCACGCGGGACGAGGGACCC
TGGGGTTACACGGAGCGAAGGTTGTGTTGTACGGGTGCTCGGACGGCACATCGGTGACGCACCAAGCCGACCATCAGCTGAGCGAAGTTTGCGAAGCGTC
ATTCCGAATGTTCGCGGAGCTCTTCGACCTCAGCCTGCACCTCGTGGTGGACGATGTCTTCGACAGCGCACCACTGCGCAGAAGAACGCGGAGGAAGTCC
CAAAGCCTCGTGCGCAGTTGCAGGCAGCGGGTCACCCGTGCGGCAGAAGTGTGCAGCATTTGACGAAGGCTCGTGCAGAGGACTGGAGTCGGGCGAGGAC
CTGAGGACCAGCTGAGTACACGCAGGGTCCGACGAAGCCCCGCTAGCGGACGGCAAAGCGGGAGTTGGCACCACCGAGGCCTCCGAGGCCGGCGCCAACG
AGTCGATGACCTGCCCCGTGGGGCCACGCAATTGAGCGTCCTGCAGCAAGATGCAGCAAGTTGAAGACGGTTAGACGCGATGAAGAGATCAAGCACAGTA
CTCAGGCACCTCGCACGAAGACTCACCTGGACGACTGGACCGAGGTCCGGGAAGGTGAAGGGCGGCGCGCTGCCAGGACCGCCGGAGGACTGCATGGCGT
CGGAGCGCAGAGAGGCACGAAGGTAACACGGCACTCACCACTTGGGACGGCTCGGGCCGAGTTGGGGGCCGCTGTGAGATCGGGAAATGACTGCGGCCGG
GCGAGTTCCGGCCGAGGTCTAACTGCCTTGAGCTTGCGAGAGATGGCTGACCGAGGGCTCTGATTGGTCGGTCACATTCCCCGCGCGTTAGTGCCCAGAA
GATTGATAGAGACTACGGAGTGACAGAAGGGTCTCGGCGGGTCAAAATAAACCGCCTGCCGAGGCCTCCGAAGTTTCATAGTGGGTACACTTTATGCCCA
GTAGGAGTTCGGATTTAGGACGAAGCTTCGTCCGATTGTAGGATCAGCTCGAAAGCTCGGTCCACACTTGATATTTGTATAGACCTTAGGGATTAGCTAT
AGGAGAGGCCTGACAGCCTCTAAATCATTAAACAGAGCAGAATTTCCCCCCAAGCCACACAAGGGTCAAGTCCGTCTACGGTAAGTCGCTAAGCTTAGCG
TAGGGTCTGGATACACTCGGCTGCACGGGGTATGTCTGCCGGTGAGCATAAGGTGCATTGACCGAGTGTTCATCCTGGTAAGGCCAAGAGTGGGTAGGTG
GCCGAGTGTTGGGAGGTATTAGAGACCTCTGTGTACAGTTGTACGTTTGACTGGGTGTGAGGCAAGGACCCCCCAGTGTATTTGACTTCTAGCCGAGGCT
TCGCCCCGGCGCCCCTGTAAGAGGCTTCGATTGGCCTGGTACCCTTCCTTTCTGAGGGACCACAGAGGTTTAGTGCGAAAGCACGTATTACACATTGCAC
CCTAGCCGTGGCTCATGGCTAAGGGTGCTCTTATATTTTAACGAAGGGTAAACCTACCTGACCCGCAACACACAGGGAGGCACATTCCAGCCCGTATAAG
GGATCGGACCTGGTCTTCAGGTTT