Description :
From Genome Similarity Track
Location :
Scaffold_36:3019- 5792
Transcript NameFunction/comments
Physo_135086reverse transcriptase

Sequence
2773 bases(100 bases per row)
CGTTCGTCGAGCGCTGCGACGACATCTACGAGGACTCCTACTTCGTCGTCGGCAACGCGGCCGACGGAGCGACGGAACCAGTGCGGCAGGAGGTGGGCGT
GTACCAAGGCTGTCCGCTCAGCCCCCTCCTGTTCATTGCCGCGCTGGTGCCGTTGCTCCGAGCATTGGAGAAGCTCGACGGAGTGGGCGTCGCGTTGGCG
GACGGGGTGCGGCCATGCACCACCGCCTACGCCGACGACCTCAAGGTGTTCAGCGACAGCGCGGCCGGCATCACGCGCTGCCACGCTGTCGTTGAGCAGT
TCCTGGAGTGGACGGGGCTGCAGGCCAACCCAGGCAAGTGCGCCTTCCTGGCCGTGACACGCAACGCGCGCGGCAACCCCGCCCACGACAAGGACATGAA
GCTGTCGCTCCACGACGAGGAGGTCTCAAGCATCAAGCTGCACGACAGCTACCGCTACCTCGGCGTGGGCGACGCCTTCGATCACGTGCGCCACCGTCTC
CAGCTAGAGCCCAAGCTACAGCAGATCAAGCGGGAGGCGGTGGCGCTGATGCAGTCGGGGTTGGCGCCGTGGCAGGTGGTGAAGGCGCTCAAGACCTACG
TCTACCCCAAGGTCGAGTACGCGCTCCGCCACCTCCGACCGCTCCAGTCCCAACTGCAGGGCTTCGACCGTGTGGTAGCCAAGGGCCTGCGGCACCTGCT
ACGCCTGCACCGCTCGGCAACCAACGAGGTGCTCTACGCACCAACGTCGAGCGGGGGCTTGGGGCTCCAGCCGCTGGTGGAAATGCACCGCGCGCTGCAG
ATCGCCCATGCGTGGCAGATGCTGCACTCGAAGGACCCAGCGATCCGGGAAGTGGCGCGCGCACAGGTGTGGCAGGTGGCCCGCAAGCGTCACCGCCTCC
GCGAAGAACACTGGCGGGGGCGTGACGACGAGCTCGTGCGGTGCTTCCTCAACTCCGAGCTCGCCGCCTCGCCCCACGCGGAGGCGCTGCGCCGCCACGG
CGACATCGGGTCACTGTGGTCCGACGTGCAGCGGTGGCTGCGCATCTACCACCTCAGCCTGGTGGTGCAGGACGACCGCAACGGCCTGGACCCGCTCGGC
CTCCGCGTGCCGCACCACGCCAAGTGGCTCGACCACAAGAGCGTGTTGCGGCACGTCAAGTTGCACCTCAAGATCCGCCACCAGACCCGGTGGAAGGGTC
TGGCGGACCAGGGCAAGACGGTGCGGGCCCACGGCGGTGTCGGTGCCAAGTTCATGTCGACATGGGCGGGCCTGTCGGACGACGACTACCGCTTCGGCGT
GAAGGCCCGCCTCAACCAGATCGACACGAACGCCGTGCTCAAGCGCAAGCGGCTGCGGTCGCACAAGACCTGCAGGGACCCGACCTGCTCCTCGGCCGAG
ACGCTGGCCCATGTCCTCAACCATTGCGAGTCCAACATGGACGCAATCCGCCAGCGTCATGACGACGCCTTGGAGCAGATCGGGTCCAAGATCCGCAACG
CGCTCAAGCGCGGCAAGTCGACCGCGGAGCTGCGCCTGAACCAGACGGTACCCGAGTACACGGGCGCAGCTCTGCGGCCAGACATCGTACTGCGGATCGT
GGCCGCCAAGAAGATGGTGATCGCCGACTTGGCGGTCACGTTCGAAGAGCACGCGGCCGGCGCCCGCCACTCCTCGCTGCAGCTCAGCCACGACCACAAG
ACACTCAAGTACCAACCGATCGTGGCGGAGCTGCAGCTCAAGGGGTGGCAGGTGCAGACCGCGGCGATCGTGTACGGGTCGCTGGGCTCGGTGCAGCCCA
GCAACTTCAACACCTACACGGAAAAGTTGAAGCTGCACAAGCGCGAGGCTCGACAGCTGGACCTTCAGCTGTCGAGCCACTGCATCCGCGCCAGCCACCG
CACCTGGGGCTGGTACTGCCGGCGCCACCGCGAAGGACAACGGAGCGGCAACGCCTCGCGAGCGCCGCGTGGGTCTGGGGGGGGCCCGCGGCGCACATCG
CAGGCTCGGGCACGGCGGTAAGCTGGTCATTTGACCAACAGGGCACTACCCAGGTAGGGAACCGCCCTTCAAAAACCCAGGAAGACACAAACACCCTCCC
TTTAGTGACATGCATATTTTAGCCTACATTTCAGTTACGGAGAGGTTACTAACTGGTAAACACGAACACACATTCTGTTCTAATCAGTGTGAAAACTGGT
TTCCCTGCTTTTGGTGGGGTCTTTTTCACATTTTTTTTTGGAACTGCTGCTTTCGGTTAGCTTGCTAGCCAATCGCGGTACGGTCTCCGGGGGCTTTCAC
CCATCCCCCGCGAGGCCAACTACACTTGATCTTCTCCGTTTCCTCTACTCTTATTTTTGCATCAACTGTTAATATTGACATATTTCAGCCTATTGCTATA
TTTTATAATGTTATTGCTATATTTCGTAATTCTATCGCTATATTTCGTAATTCTAGTGCTATATTTCGTAATTCTATCGCTATATTTCGTAATGCTAGTG
CTATATTTTATAATGCTATTGATAGGTTTGGCATTATCCACCGCAGCTTTTTGCAATTTAAAAGTTTCACTTATCCGACGTCACAACGGAACAGCTGGCA
CTGTTTAGGGTTGTGGACCTTCTCGGCCTTTGGCTAAAATCAAGTGTAGTATCTGTTCTAATCAGTGTGAAAACTGGTTTCCCTGCTTTTGGTGGGGTCT
TTTTCACATTTATTTTTGGAACTGCTGCTTTCGGTTAGCTTGCTAGCCAATCGCGGTACGGTCTCCGGGGGCT