Description :
From Genome Similarity Track
Location :
Scaffold_100:3019- 4843
Sequence
1824 bases(100 bases per row)
ACACGGAACAGCCCGATGTACTTGAGTAGTAGTTTACTACTACCCACATTAGTACTACGTGCTTAGGTAAATTTACCGTAGACAGTAGAACTAAGTTTCC
GACATTAAATAGAAGAGCATTGATTTTACATGTTTTCAGCGTTCCGTTTCTGCCGGTTCACTGCGTTAGCGATGAAGTTTTGCACGAAACGGATCACTGC
TTCTCGTGCCAGCAGGAAATCTTCTGCTGACTCACTTTGATTTGTTGCATTTCGCCTTGTGCGCAGCGCCAGGAGGACATCCTCGTTTTCAGCGAGGGTA
TTATCATCCTCGACGGTGTAGTCATTGGTGATGCTAAATATACCAGCATCGCCATCCTTATTTGGCTCAGCAATAGTGTCTTCACTATTGCTGAGATCAT
CAGCTTCGATTTTAATTTGATCAACATCGGCAACGTTCGCGTCGTCGATTACCTCGACACGTGATGAGCAAGAGCCAGAACGGTTTTTGCTCGAGCGAAT
CCCTCCCCCCCCTTGGGTTAGTGTCATACTCTAAATGGGTGGGTAGGCGTGGATGGCGTAAGCCGTTCACGAAAAACGGTGTATGCGCTGTCGATGCATG
CACGGGGTTGTTGATTGCAAACTCCACCATCGGAAAAATTCGCTCCAATCTGTGAAAGATTGGACCTATCTTTAAAGGGTATCTTTGAGGACTCGGCTGA
AGCGTTCTGTTTGACCATAAGTCTCGGGATGGTCAGAAGTGGGACATAGTCAGACGTGAACCAAGGATCTCTATCAGAGACTAGTTCACGGGGTAGACCC
TGGAGTCGGAATACCGTGTCAATGAAGACACGGACACAACCATGTGATGAGATTGACTCATTAACTGTAGCAAAATGTACCATCTTGCTGAATCGGTCTA
CGAACAGAATAATACTGTTATTCTTGTGAGCGTCTTCAGGTAAACCGAAGACGAAGTCCATTGAAACGGCTACTAGCACTCTGCCAGGATTGGTAGAGGA
ATGACTAAACTTCACCCGTTGGCACACTTCACAAGCACGGATGTACTTGCGCCCAAACTGATACTGGAGGGCCAGTAAAAATCTCAACTTACCGTGAGAT
ATTTCTTCTCACTCCCACGATGCCCACTAGGTGGTGCATCATGGCACTCATGCAAGGTGCGCAAATAATTATGAGTGGGGAAGACGACACGAGGTGTGTC
GCCAGCAGCGGCTGTATAATACATCAAACCCGTTGCGTGTTGTGTATCGATCCGCGGAAGATTGATACAAGGCCGGTAAATCTTTGAGAGATTTACGAGA
TAAAGTCGCCAGATGATCCATTAGTCGCAGAAGAGCCTTATCTTCTGCGCAGACCTTTTTTATGTCGTCAAGCAACATTGATGACGGAACACTAGTGACT
AGTGTTGCAACAGTGGTATCAACCTCATTGTTGGACTGCACAGACGACTCGAATTCAGGTCGGCGCGACGACATTGAGTCGTCCGGGTTTATACTCTACG
GAGAGTTGTACTACTCAAAGAAGGACAGCCACATCGCCATTATTTGCGAGAGGTGTGGGCTGTTTAAGGCCGTTCGTAATGACGCATGGTCCGTACAGAC
TACGAACGGCCTATATCCAAGGATATAGACGAGAAACTTCGCTAGTGCATACTTCATGGCAAGGAGTTCCTTGTCTACACTGGATAATTACGCTCAGTTG
CTTGCAGCTGACACGATTGATAACAGACGACGCGCTCTGCGCCGTCCGCATCGTAATGCATCAACGCGCAACCGATTGCGAAATCGCTGGCGTCACAGAC
CACATGGAATGGTCTGTCTTGGTC