Description :
From Genome Similarity Track
Location :
Scaffold_247:3019- 4272
Sequence
1253 bases(100 bases per row)
GTCGACTGCTTTACCTTCGTATCATAGGTGAAGAAGTCACGGACGGCTACGTGCCTCGCCACAATAGGACGCTTCGATGGTCGTGCAGCGCGTTCGACGG
GCCGGGGTAGAGGTAATTGAGACCATACACCACGACACGCGTCGTTGCTGTGGCGATCGGGCACGCAAGAGCAGTAAGCGTCTCGCATGGTCCGTAAATA
CCAATTCATGGAGACAAGTGCAGTACTATCGTCATAAGTATTGCATGACCATTTCAATGCGCCGCCGACGTATTTAGCATTGTACAATTGCAGGACATAA
CCGAGTACCGAGTTTGTCATGTAGGCTTAGGCTACACAGCCATCGAGCAGCGTTTATATGTTTAATAAACACATACTCCTCTCTCTCCTCTGTTTTAATC
ATTACTTTTATTGATTCCATGTGGCGATGATCTATGACCTGCAGCTTTAGTTTTGTAACATGGAAATAAATCCTCGCTTGCGGGTATCCTTCGGAAGGAT
GCCGGGCACGGCGGTCGCAGTCGTGACATGGCAACGCCATCAATGGAGCATACACACGACCCAGGCAAAATTCCCTCGCAGCAAAATTTTCGGTTTAGTC
GACAGCTGGGGTCGCACCAGTCCAGTGGCACATGAACCTCGCCTGAGTCGATCGCTTCCAATTCTACTCTTGGCACCTGGAGCCTTATATTATTCAGTCA
CCCATAGAATAGCGTGGTAAACATGAAATTCGTCACGAAGTGGTACTGTTTATGCAACTGGTGCGGGTTTTGCAATGTTTGCATCTGGATGGTGCTGGAT
TTGCGATTTACTCTATAATAAAAGCTATCTCTAGGCACCTAGTTTGCATCCACTGACTCTACGGATTTTGAGCCGCCGTGCCCGTCGAAAGCCGCTTCAT
TCGAATACCAGTTACTGTCGTCTTTATTCACGATACCGTCTTCGCTCGACTGTTGGTCTCGACCGAAGATGCTTTACAAAGCAGTAGTTCATGTCCTGAT
ATTCAGATGTGTATGGCTCATTTCCACATGAGCTGAAATGTCTGTATCAATACCCGCACTAAGCTGACGCTGCCTGCTCGTTATCCGCTGTCAATACCAC
AGCTCTGATTCACCTATGAAGGCAACGGCCGAAAGAAGTGACGGTCGTAGCTTCACACTACGCTCACGTCCCACCAGCAGCAATAAGATTTTTTAAGGTT
AAGCTGATCAATACATTCGTATTCTTCGCGACGACAAAACTCACGCCCACGAT