Description :
From Genome Similarity Track
Location :
scaffold_66:30184- 32943
Transcript NameFunction/comments
Pl_110626hypothetical protein PHYSODRAFT_353720
Pl_110627conserved hypothetical protein

Sequence
2759 bases(100 bases per row)
TTCGCGCTTAATAGTGTGCACAGGTAAACAATGGCAATGCTCTGAGCACGTGTACAGGACGAGATGGAGGGAGCGTAAAGGGGGAGAGCAGGTGGCATGC
TGTGTCGGAGATTCGCTCTTGCTCCTCCTAATGCGTGGCCTTTTAGATTCGAGCAGGTGTTTTCTCCTCGTTTCTGCATCGAATCTCGCGCCAGTTGCCC
CGCTCCACTGCGCTCTGCATCGCAGCAGGAACTGACTGGTTATCAGTTGCTTTTCTTTTCCTTAGACTGCAATTGAGATCGACGGCACAAGACTGAAGCC
ATGAAGTTCGGCAAAGTACTGCAGCAGTCGACGCAAATGTCGCCCAGTGCGTGGGAACCTTATTGGGCGGACTACAAGCTGCTCAAGAAGATCATCAAAG
ACTGCGCACAGATCAAGAAGGAGGAGAAGCTGCAGGGCGACAAACTGGTCAAGATCAAGATCAAACCGTCTGCAAAGGAGGACAATGACAGCATTCGTGC
GTGACTCTAGCGATTTATATGTATTTCGACTTGTACTTACTTGGATATTTGCTCAACAGGTCAATCGCAGGATGAGATGAACTTCTTCCGCACGCTACGT
ATGGAGATTAAGAAGATAGCAGACTTCTTTATCAAGGAGCAAGCCAAACATACGAGTCAGGTGGCGGCCATTGATGCCAGTTTTCAGCAACTTAAGGTAT
GGACTGTTGATAGAAGAACGATATGGTCGGATGATAAGTATTGCCACGGAGGTCTTACTAGTCATGTTCTTTTTTCGTGGTTTGTTGTTCAGACAAACCC
CGATTCAGCGGAAGCTAAGACGGCACTCATGAAAAGTTGTGTCGCGTTATACAAGGAGTTGCTGCTACTGGAGAACTTTGCTGTGATGAATTTCTGCGGT
ATTTCCAAGGTTAGATCGTTGACAAGTTGCCAAGGAGATACTTTTTAGCTCGTATTGACCTCGCATTGAATATTTGTTCAGATTCTGAAGAAACACGACA
AATGGACGGGGTACGCTACGCGCAACAAGTTTATGCACACGATCTTGATGAAACAACCGTTCGCGACGTACGAGCCGCTGCTGCAAATGATCGATCGGCT
GGAGCATATCTTCATGCAGGCAACAGGATCTAGTATTGAGCAGCACGATGCGCAAAAATCATCTTCTAGACGCGGTGGCGGCGGCAGCTCTTCGTCATCA
CCTTCGGGAGAGACACATGGAAACTCAGGACCCGCCACTGGCGGTGATGACACTTCTTCTGGCAACAATGACGCGTCAAACCATTCTCCAAGTCACACAC
CACCTGGTGCAAGTGGTGGTCGCCATGATGGACGAAGGTATAGAGGCGCTGTAGATGAGTCTTCCCCAAGATCTGAGGATTCAGTAACGCTAGTGCGAGT
AAATGCACTACGAGATGATGTGCGGGAGCTCAGGAAGATTGAAAGCGCATATGACGGTGATGGAGAATACGAGGATAATCCCGACGACGCAGGCTTTCCT
GATGATGAAGCAGAGGTTCCACCACTGCGTTTTGGCGGCCGTCCTCAAGAAGAAAAAGCTATCCTTCCCCCTCTACCGTTGCGTGTTGCCCCTGCCGGTA
CCCAATCAGACAGCGATGCAGCAGCAATTGCCATGCTTTCTATGAAAGATAGCGCGGGTCTCCTCGCGTCTGGAATTAGCAGTGACGGTGGTGACAGTAC
ATCTGAAAGTTGTCGTACACGGAGTGCTAAGCGCAAAGCTTGTGCACCGTTAGACATGGAAGGCAAGCGCAAGATGAGCGTCACCGCGATTCTCAATTAG
CCAGCGCATTTTACATGAATACAACAGGATGTCAATTCGTCGAACATGAGGTTTTCACGGGTGGTCCACCTGCCAGATCGAATGCACCACCAAGTTTCAC
TGCGTGACCTGGTGTCACTGATTTTGATCGCTTGGACTGGAAGGAAAGATGCTTTGCTTTGTGGTTGTTACCATATTCATTCATTCCCCCTTGATCCTGT
ACTCATTTGGTCTACTAATCGCGTTTCATGGTCATCTTCTAAACCAAGCTTTCCAACTACCGTACTATGAACCTACTTACACACTTGCGAGCACGAATCA
GCGTCTTGCTTGACGCGGGCGGACAGAAAGCTCTAATGCTCCTTTGCCAAGCGTACTGCTGCCATTCTCATTCACCACGCACATGAGTAGCAACACCTTC
TGCCTCTGCCTAATTTCCAGCGCACAGAACACAGCAAGTCGCCTAGTAGTAGCGCCCAACTAGAAAGAAAATGATCGCGCACACCAGCAGATGCAACGGT
CCAAAAGCCTGTACAAAATACAGCATCACAATCAGTGTCAAGAAAATCACCAGGGAGAACGGCAGTACGACGTACACCCTGCTCTTTTGGGCCCTTGCCC
ATGATCGCCTGTGAGTCTTCGTTGCCAGATGCACCATTCACACCGCCATTCTTTCGATGACGCAAACCCGTCGACTCCTCCGACAGCTTTTTCACACGTT
GAGCGTCGGTGCTAGCCTTCTGCAACAACTGTCTGGTTTTGTCCAGGTCGCTCATCAACACATCGCGCTGTGCTGTAAGCTGCACAGTAAACGCCACCAA
CTACAAATCCAATTAATCCCTCTCGATCATCAAATAGAAAATATCCCCACTTACTTCGTCGTATTTCTTGCGGAGTGCTGCGACTTCCTGAATCGCTTCT
TTGCCTCCTTCCCTGTTCTCCGCCACCTTCGGAGCCGGTTTGTCATCTTGCAACAATGC