Description :
From Genome Similarity Track
Location :
contig_38:301834- 317236
Transcript NameFunction/comments
g8370.t1hypothetical protein
g8371.t1XP_009515485.1 hypothetical protein PHYSODRAFT_551932 [Phytophthora sojae
g8372.t1hypothetical protein
g8373.t1ETI37614.1 hypothetical protein F443_16384 [Phytophthora parasitica P1569
g8374.t1hypothetical protein
g8375.t1hypothetical protein
g8376.t1XP_009515479.1 hypothetical protein PHYSODRAFT_476945 [Phytophthora sojae
g8377.t1hypothetical protein

Sequence
15402 bases(100 bases per row)
AGCTGAGGAACATTCTGGGCTCTGAAGAGGAGGAGACGAAGGAGGACGAGGGGTCTCTAGCAACTGAATCAACAGCCTTGGCCGCCGCAGCTGCAGCCTC
TGCTGACAGTACCCCATCGGCCTAAGAACACTTGTGAATGAGTAATCAGTAGCGACAGCAAGTATCTTGCCACAAACATGCATCTCAAGTGACTTTTTCG
CCAAATACATAATTTATTTCAAATATTGCGGAGCTGACTCGCAACTTGCTGGGAAGCGGTAGCTTGCACAAATACTTGCTCGGACTCCCAGCTTAAAGGC
GGTGCTGACGGTTGGTACTCATGAGCGAGAGGAATGGGATCAATCGTCGGCAGCGGGTCGTAGTTTGTGACCCCCAGCAACGGCTCTTCCATGTCGCTCT
CCATCATCGTAGCGCTCGGAACGCGCGCCATCTGATGGTGCCGCTGCTTCCGGAGGCAGCAACGGCGGTACAGGAAGCAGAAAGAGGTAGGAGCTGCACA
AGAAGACGGCCACGAAGCACACGAGCATAGCATCCGCCCACTGCATCCGCTGGAGCCGGGCGCTCTGCTGCAGCGAGGAAGGCGCGTCCGTGTCGATCCA
CATCTTGAAGCACGAATTGGCAATTGAGTTTTCTCGCACAAATTTTGGGTGGGACCAAAACTTGGCAAAACTCAAGTCGCCGCGGACAAGTACCATAAGT
CATATTCGAGCTGCAACGTACCTTGGCATCCAAATGATCAATGGTTACGAGTGCTTGGGTGGTGCAAATGTGACGGGTTGCGGCACGATGGACCCTCTAA
TGCGCCTTACATATTACGGATCGTGATGCAATTGACCAATGCACGATAAACATGTGCAAATTCACTTCATTAAAGCGCACAGCAGACAGAATTACATCCA
TGGTCTTGTCACTTAGCCACTGGGCTGCCCACCACCTGGTCCATGAGTGAATTCTCGATAAGCTCCTGGCTGGCCGTGATGCTGTTGGCAGCAGCGCCCA
TCATGAACTTGGTCATGGCTCCCATGACGGGGGAGTCTTTTTCTGGTTGCTCTTGTCCGTGCTCGAGCGACACCAACGAGCACATCTGAAGTAGACACCG
CGGGCCGACGGACTGAGAAGGAGGCACTGGTGAACGCTTGGCGACAGCATAGCATTGGTGGCGGTGTGTCAGCCCTGCGAAAGGTTCGTCCACCACTTCC
AGAGGAGTTTTGATCGAGATAAACACCACCACAACACGGTCCTCCTCCACGTAGCGGCGAAGAACTTGCTTGACACGGAACATAGCGTGCGTCGAGCCAA
CGTACATCTCCTTCGCGAAGTTCTCGACGATTGTATCAGATTCGTCCATGACCTACAGTGCACATACAAGTTCCAGGTAAGCAACGAAACTGATGCTGCT
AGCAGCGACACTGTACCTTTGCAGTCTTCTCGTACACCTTGCCTCTGTGTTTGTCAGCGCCCTTGAAGTGGTCCCATACCGCCTTTGCAGTGGTGTCCAT
ATCAAAAGGAAGCACTTTGTTGGAGAAAACGTCCAAATAAATGCCATCGTCTCCATCACGCATTTGGGTGTCTTTATATGTGACCTCCATCGAGTTCAAG
CCATTTGTGCAGAATACAGCATCCATCTCGCGGTATGCACCCTCCAAAATCACAAGCATATCTTCAAAGTCGCCAAGATCCGACTGGTAGTTCACCATAC
GACCTACCGCGAAATCGGTCGTGTCCGGCGACACAGTGCGAGAACACTCCATAAGCTGCACAATCAGCACGACTTGACGTAAGAATCCAAAACAACTACC
AAATACAAACAATAGCAGCCGCCATTACCTGATTCTTTGCTCGCTTGAGTAGCAGCATCTGCATGCTCTTGGCAGCTTTGAGTTGGCTCTCCAGCACGAG
TTTCAGCCTCGCATTCTCGATCTCTGCTTTCTCCCTGCGCTTGCGTTGCTGTTGTGCCACAGGCTTCCACACCGATTGTTCTGCAACGGACGAGGGCACC
AGGGCGCCATCATGGCCCGCACTTGCATCTTCGTGCCCATCCTGCTTGATCAGCTTCACGGACGTTCTGTGCTGCTGCAGAGTGTCCAACTCGGCCTCCA
ATTGGGCCACTTTCTCCTTCAAATACGCCACCTCAATGCGGCGTTCGTTCCTGGCCCGATTTGAGTCGCCAGTCACCCAACTCTTGCGCAGCAGCTTCTT
GGCCGTCGATCGCCTCGGCGCTCGCGTGCGCTTGGGCTTCTCGCGCTCGATACGACGTGGCGACCCGTCCTCGTCAGTCGTTGTGTGGTGGTTCTCGCTG
TTCGACGCCGGTGACGACATTGCGTTGGGGTTCTGAGGCGACGAAGCAACCGACGAGGGCGAACCCGTGGAGCTCGGGAAGCCCAACGCCCACTCCATCT
CCTGCTTGTTCAGCACCTCTAGGGGTTGGATGGGAATGGGCGCGTCGCCGTTGCCGTCCGCGAACTCGTCCACGAAGGACAGTGCAGCTTCGAAGGCCGC
CATCTCGTCGTCCGCCAGGAACGCCATGGCAAGTGCTTCTTTGTCGACGCTGTTCAATACTGAAACATGAATTGATTGCTGAATTCCGCTGGTGCAGGTT
TTCGGCCAATGGCAGGCTGTCAATGATCTGGATATCTACCAATGAGTGCATTGTGGAACCTAATTGTTGAAAAAGCAACATATCCGCACTGAACCAGGAC
GCGGCATGGATCGGAGAATCTGGTTTGAAAGTGGACGTGAAGGAAAAGTATTAGTACGCGCGTAGGAAGCCTACCGTCCAGACGGTTGAAAGCCGCAGGT
CGTCGTGGGTTTGGCCGCCGCAGTGCTGCACAAACTGCTGACACAAGCACGCACTAGCAGAAAGCTGCATGCTGCAGCATGCTGTATTGGTTGCACTGCA
TAATGATGCGACGAGCTCTCCGCGCAGCATTCTGCTACGCACTGCACTGCGTAGGCTGCATACTATACGCAATATTCAATTGATTGTGTGCTGATAGTAT
AATGGGAACGCCTGAGGTTGGAGGATCTGAGGGCTGTGAGGGTGGGCTGGCGTCGTCCACTCCGAAGGACAAGTTAGGCAAGCCGGTGGGTATAATGAAG
ATATGTATTAAAATATTAAGAAGGCTGTACAGGTCACAGTGTGCAATGACGCCGACGCCGCTGTCTTGGCGGAGTAGCCATCACGTGACTACCTAGACCC
ATTGAAAAAGCAAGCGCTGGATATGGTTCGGGTATCATTGGCGCCGTCGCCGTCTGCCAGTCAGCGCTAGACAAGTGGAGATGGAGATATGAGCGTGGAA
ATGATAGATGAGTCTTTGGTTGATACATGAGTTTGTGGTTGTCGAGCAGAGTGGAAATGTACATGTCTTTCAAACTCGTTGACAACGGGAGACCGTTGCA
CTTGCGGTGGGCTTGGCCAATCAGGGTCCGGCCATGTGGTTTTGCCAAGCAAGCAAGTTCAGAGGCGCCTCATAATTCAAGCGGCGGTACGTCGAGCGAG
TGCGTCGAGTGTTTCCAGACCATAGCAGCATCGGACCCAATGACGGCAGCTGTCATGTTCGCGGGCGTGGACATCGGGGGAACGGGCGTGAAGGTGGGCG
TCGTCACGTCCGAGGGCTGTGTAGTGGCGCGCGAGCAGAAGAAGTACCACCCGGAGAAGCACGAGCCGCAGGACGTCGTGGATCTTGCCGTCTCCGTGCT
GCATCAAGTGCTCAAGACGGTGCGTGCGTCGAAGTTGATGGTAATTAGAGTGAGGTGTCTCACCAGTCGTCTACCTCATGCTGGCAGACGCGATTGGGAT
TGGGGGACCTGGAGGCGGTGGGCGTCGGCTGCCCCGGCGTCCTGGAAGCTGGGGGCGTCATCCACGCAGCTGCCAACTTCCCGTTCTGGTTGGATGTGCC
GCTCCAGCAATTGTTCACCGACACCCTTGGCAGACCGGTTAGTGGGGGGTGTTTGGGTCTGTGGCTTGAGGAATGTTATGGTGCTGACCGAAAGTGTAGG
TTACTGTGTGCAACGACGCGGATGCTGCCATTTTGGCGGAGCAGTGGGTCGGCACAGCCAAGGGTGGCATCAAGGATTTTATCATGCTCAGTGCGTTAAT
GTCGTGTGGCTTTCTTGGAGAAGGTTACGATAGGCCTGTATTGACCGGCTGATTTGGGTGTAGCACTTGGTACGGGTGTAGGATTCGGTGTCGTTGCGAA
TGGCCAGCTTGTGCGCGGTGGAAGCAATGCCATTGAAGGGGGTCACATGGTGCGAAGCTTGCTAGTATACGGGTTAAATTGACCGCTTGTCGTAGCTGAA
CGTGTGCGCTTGTCCTTGTAGATTGTGGAGCGCAATGGACGACCGTGTGGTTGCTCTCAAAGAGGTTGTCTTGAAGCTTACAGCTCGGCGGGCGCATTGA
TGTCGCAGGCTCAAGAGCACTTGCGCGCTGGTATGATGCTGGAGCTGTGTGTTGATTATAGGAAGTGAATACCTAACGATTCTGTCCACTGTGTTTGAAT
TATGTAGGAAGGGATTCGAGTCTCGCCAAATATTCGGAGGAAGATATTAACGTTGAATTCGTCTTCAAGCATGCCGCCGAAGGCGACGAGCTCTGCAAGC
ATCTGATTGAAGAAGTAAAGTATGGCTGTGGCACCGCCTTATGGTTTGACTTACTAAGTGATGCGAAACTAATTGTACAGGCTGCCGACTACTTGGGTTT
TGCCTGCGTGACCTTCTGCCGAATGTTAGACCCGGAGGTAAGGATGTTCAGCCATGGAGACAGTACTGCAGAGATAACCCTGTTTCCTTGATTGTGGCAG
ATTATTGTTCTGTCAGGGGGAATTGCCGAGGCTGGAGAGACCTATGTTGAGCAAATTCGTCGTGCCTACGCGAAGCACACGTGGACTAAATTCCCCAACC
CGGTACGCTTGGGCTTCTCGTTCCAATATCTGTTTCGATGATGTCTAACTCGTGTTTTATGTTATGTGTATAGGTTCGTATTGAAAAAGCGAGCGCGGGG
TATGATTCGGGCATCATTGGTGCCGTTGCGGTATGCAAAAATCAACGCAAATGGCAGTGAAGCTTCGTACGGTGTCGTATGCAGGCAGATGAGTAAGAAG
TCCCAGCTTCAGATATCGATGATAGTTGAATGAAGTCTCTGTTTGATGTAATGCTGGGTTTATTTGATGATCGCGGAGCGGCAAGAAACAAATCACTTTC
AGGTAGTGTGTATCGAAGGAGATGCCGCATTTCCTATCTGTCCTGAAGGAGCAGCTAACAATTGCCAATCAAGCTAGTCACTGTCGCTGTCGCTGATGAC
GGGGCTGGCATTACCGTCGTTGTGTAGAACGGGGCTATCACTGCCATCGTTTTTGCCGCCAGCGGGGCTGTTCGAGATCTCCGGTGAGCTTTCAGGGGGA
GGTGTGTTTGCCTTGTTTTCCTCGTCAACAGAAACAGGCGATGATCGCTTCTCTCCTGCCCGTCGGCGCTTGAACTCGCGCACACTCTCATCGTCATCAA
GCTGATCGTCATAGACTCCTCCGCACTCGAATAGGTCCTGGGTACGACGGTCTGTTTCGACTTCTGAGTAATCCCGACGGTAGACAACAGCTCCGTGGCG
ACGTTTTTCCTCTCCAGTCATCTGCATACAGGAAAGCAGGTAATCGTCAGAACAGCAGCGACGCGAGCCCCAAGAGCATGAACGCACATACCTTCGTCTT
CCTCAGCTGATGCGGTTCAGAACGTCACTGTATGTGAAATGGTCGGACTCCGGATCTAGCATGAACATAACATGTTGTGACTCCCTCTGAGGCAGCGAAC
ACCAATAAACAGAAATAAATCAAAGTGAGCACAACAATTCAGCTGAAACAGAATCAAAATCGCCAACGTACGCTATCAAGCGACTCCACCGCCATAAGAT
ACTCGCGGAGGTACGAGAATTTCTCGCGATCGCTACTGTCCTGTGGTAGAAGAAACAATTCACCCATTAGCTTGTGCCGCGGTGCTTTAGTGCATGCATA
ACAGGGGTGTACCTCTTCTTCTGCCGATCCGTTGGGCAGCAGGATAGAGCCCTGAATAAGTTCCTTGCCAGCTTGGGTCTTCTTGTTTACGCCGCACAGC
AGTGCACGATCCTCGCGGCTTGTGATTCCCTTGCTCTTGACATCTTCGGAAGGAAGAATATCGTACGACTGCAAGTCCACAGAAATTAGTATCCTGTCAG
CTTGTGTCATAACGCATACCGAAATTCCGCTGCGAGCAGACGTACCAGAATTGCATACTTGTTGGCAGACAAGAGCTGATCGGGGAAGACATCCCACACC
TTGGCGATTTTTTTCCTTTTGCTGTGCGGGTGCACCAACAACTTTGGATCGTTAATGTCGCGGAAGGACGCTTCGGCACGGTCCTCTAACGTCACGGACA
CAACCTCGGCCAGCGCATTCTCCGTGCCCTCACGCAGTGCACTCTGAATTTCTGCCTCGCTCTTGAACTTGTGCACGGAATCGTACAGATCGTTGCCCAT
GTACTCCGTGCGTCGCAGCCAGGAGACTGTGGGGCGCACCTTAGATCGGCCCTTGGTGCCCATATGGTCCTCCTTCATCATCAGCGCCTGCTCATCGCCA
ACCTCCAGCGGCTCGGGGTCCGTCGGGGCTGCAAAAATCCATCCGCGACATTTTAGCACAAAATTCTACATCCTAATCCCCCAGATAAGAGTTCTACCTT
CATATTTGGCCGGATCGATGAGGTCGATGGTCAGTCCGAGGTTCGGCTCCTCGTGGATCTCGTACGTGTAGTCCATCTCGAGTGTGTTGGGCTTGTACTT
GATGAGTCTGTGCACATAAACCACCACCACATCATCAGCTTCTCCACCTTTCTCCCATTCTGCAGCTCGCCACTGTCGCACCGTTCCGGCTCGTGCGGGT
ATTTGACAAACTTGGTGTCAAACGGGATGTCCGGCAGCGAGTTGCGGAACTCGAGGCTGGCCAAGAACTCCGACTGCTTGCCCAGCAACGCGCGTCGCTT
GGCTTGCGCGTGGCTCTCCAGGATCATGCGTGTGTGGTCGCGCCGCGCTTTGAGTTTGTCCTCCTTGTACTTGGCCACCTTCTTGCGCTCCAGCTCATAA
CGCGCACGTTCCTCGGGTGTGGCATTGGCACCGGGGGGCGCCCGCCTTTTCCGCGCCTCGTCCTCCTCGCGACTGCGGCCGTTGCTTTTGCTAGCCGCCG
CGCCGTTGGCCTCCGTCGCTGTCTTCACCTCCGCCATCGCTCGAAGCTCTTTTTGCTCACTCCCCCTAAACCGAGAAATGTGGTGGAGTCTAATTTACGT
GGTGCACATCATCATATTTTTGTCACTTCAAACGGCGTTTCGCGCAACAAATGGGCTGTAGTCGACTCGCCTATTAGCCATGAAGCAGCTGCTGATCCTG
GTGGCGCAGCACCCGCTCAAGGTCGGGTCCGTGGTGCTGCTGCTCAGCGCCTTCTACAGCTTCGCGCGCGTCCTGGTACTACAGTACGTTGTGGGCTCCG
TCCAGGACGCCATCGTGCGCTACCCGAAGAACTTCCCGCACGCGTTCTTCCTCCCGCTTTTCCACGTGTCGCTGGCGGTGGCTGCTGCTGCTGCATTGTA
TCAGGACTATTGCTACAATCGCTTCTGGAGCTCCTCCACACCCACGCAGCTCTGGAAGCACGTGCTGCCCCTGCCGCTCACACTGCACCCCGGCAAGTGG
AGTCGGTTGGTTGGCATCCCTTTGTACGCGTTCGGCATTGCAGTTTTGGAGGCTGTGCTTGTGTTCAGGGACCCTACCATAGAGAGTGTGGCCAAAATGG
TCACTAGAGTTTTGTTGCAGCCGCCTCGAGAGGAGGGGCAGGTACTCATGCCAAAACACGTTGCAGGCGTGCTTTTTCAGGATCAAGCGGAGGTGGCCTG
GAAAATACTTACAGGAGGTGCAGCAGCTCAGAAGTCATCGACGCGTACGTTTTCGTACGTACGACTGCTCGTTGAGATCTTGTTGGCTGCGGCAGTTTGT
GTAAGCTTCGCTCTTGCGCGGTTCTTTCGAGAGCCTCAACACGGTACGTTGCCGCTGCTATTGCTGGGTTAGTTTCTGTATAACTTACGCCTTGCGTAAA
TACTTGTTGCATTGGAGTGATTAGATGGGGATGAACTGCGCGAAGCTGCGAGAAACAATGACATTCTAGGAGTGAAGCTACTTCTTGCTCGGGGGATGGA
CCCGGATGCTTGCTCTGGTGATGGCACGACGGCATTGCACGTCTGTGGGCAGCAAGCAATTGACAGGGCCGCGCAGGTTCTTCTTGAGCACGGGGCAGAC
GCGAACGTAGCTGATCGACTTGGATTTACGCCACTACATTGGGCTGTACAAATGCGACGAGAAGAAGTGTCGACTTCAAGCCGTTTGGCGACGATTCGAA
TACTGCTGCACCATTGCGCTGACCCACGCAAACCCGACTCAAACGGCACAACGCCGTTAGTAATTGCATCACGAAAGGAGAACGAAGCATCGTTGGGAGT
GCTAAAGGAGTTCTTGCCTGAAGGTGAAACTGGTGGAGAGGTAGAAACCACCGAAACGATAGACAACGCCAGCGTGGACTTGGCAATTCCGAATAATTAG
CAAAATTACCACTCATCGACTACTAAATCCCGTGACGTCCATCTCTATTACCTACCGTTGGCACCACAATCATAAGGTCTGCGTTAGTTCAATGTAACCC
AAACGCACGATGCCAAAGCACGTACCATTGACAAAATCCTCTCTAGCTCTGCCTTAGAAGGATAGAGTGGTAGATCCAGCCTGAACCAGCAAGGCAGTGG
TCAACAAAGCGGCTTGCAGAAACACGGTTCAAAATATGCACTCACCTGTTCAAGCACGTACTTGCATGCGGTAGTACGGTGTACACGGTTGAAATATCCT
TCCCAAGCTGGATTGTGAAAAGTTGGATCTCGCCATCCATACCAGTCAGACCCTGTATATTGAAGGTCAGAACCAAATTCACTTAACGCGTAGTGAAGCC
GAAAAATATACCTTAAAGCCTTCGACAGGAACGCCGCTGGAACCAGTGACGTACTGCAGCAATCTTCCGCGTTGATCTTGCGTGAACGACTCTAGAATTT
CCCAAAACCAGGCAACCAATTCAAACTCGTGACTACTTTGTTCGTAGAATCGAATATCTGTGTGCTGTCTCCAGTCATTGACATCGATTTGAGGTAATCC
AGAGAAGAGTATGTCAAGTTCCTTGAAATCAAATACGTGAAGAACTGAATCGCTGATGACACTGCGCAGACCCTCCATGATGCTCGAAATTTCCGCTCGA
ACACTGTCAAACAGATAGTACTGTGCCACTTTTGCAACGTAAAGCTGTTTGTTTCCATCGTGAAGAATGACATCGGCGCCATTTGGAATAAGTTCTGCGC
CATCCACCGTGAAGTTCAAGCCGAGAGCATTTGTGTTATCGTTTTCGAGGATCCACATCATACTGGAATGCACCGTTTCATCGAGCAGATATAGGTCTGA
GAGCTTGAGTGGCACGCCGAGAATGTGCTTCAGCAAAGGGACGGAAAGCCGCACGTTTAGAAGTAGGCCTTCAAGCAAAGCCTTCCCCAATAGCTTTCCG
AAGAAGACGTACATCTGTTATTATGAGCATCAACCACAGTTAAAACAATTTGTGATGAGCAAAGAGGCAATGCTTTGGGCATACCTGCAGCTGCTTCGTG
CATTTCCCCGTCGCAGTTCGATTAATCCAGTATCCCTGGTGCGCTGCTGAGCTGGTTAGTGTGAACAGCCCCAGAGATTCCGCAAAAAGCTGGCTGCAAA
CAAGATGCAGCCACTCCCGCAAAATGCCACCACCATCGACGCCAACCTCATCCATAAAATCGACGCGTAGTCGGCGATGTAGAGTTGCATCCGGTGCAGA
CATAAAGAGAGTCATTGACTGCTTCAACACCCTGTCACGATGAATGCCTGCAGCTTTCGTCAGTTGAGCAACCTGAAAATCACAGCCACAGCTAACGTAC
GTATAGTATGGTAGCCATCGACAATGGACGAGCAGAGCTTGAGCGAATACTGGTAGAACCACTGTGCTTTCTCGGAAAATGGCAAGGTCGATACTCGCTA
AGAGAACCGCGCACAAAAACATTAGACAAGAGTGATAAGGCTTACCCGACCGACTGGCTTACCATGATCGTTTTGGAGTATGGTCGTGATGAAGTTGAAA
ATTCCTCGGCTAAGCGCCAGCGCACAGTTCGGCTTCCCGAGTGTGAGTCATCTCGCACGAATGCAGTTCCTGGGGTGAGCCAAGAAAGTTGTTTCCCACT
GCTGTCCGAAAAGATGACAGAGGAAACAGACATCCTCGAGGACCCAGGCACCTGTGGAGGGTGTTGTATTTCCCATTCCTGAAAGTCACGCTCTCTAATA
ATGACGCTGCATAAAGCCTTACTCACTTGGAGAGCTTCAAAAGGAACGTTTACCTGTAAGACCCAGAGTGCATAACATTAGCTATACAGATCATTATCGG
ATCCGAAACTTTTCACCCCTTACCCAGCGCACATGTTGCCCTCCAATACAGCGCTTCCACTGATGCCGTTCGCGTGCAATTAACTGACGGTCCGTCAAAT
CTTCACTAGGAAGAGCGTTCAGACCTCGAATCCAGGCAGCACGAGGAGAGGACATGAGGAGATAGTTTGAGGCCGAACGCTGGCTGATTTCACCTTGGGG
AGCGCTCAGTATGGAAGCACTCGCATCTTCCTGTCGACTTCTGATCATCTTTAGCTCTGCAATCCACGAATCCAGCACATCAGATCACAGATAAACCATG
AAAAACAAATTCAGCTTTTTCAAACCTTCAGCCGTAGTACCGCACAACACGCAGTCGGTCTGCGAAAACTCGTTTGTGTGGTAGCAGATCTCGCATCTCC
ATCCAGCATTTCTACAAAAATGCCACGACACCGGAAAGATATAAATCCCCGATCTCACTTGATCCCCAACGTTCAAAAAGACTCACGATCGTTCGATGAA
GGCGCGGTGGCGCGACCGCCGGCTCGAGCTCGTGCAGCACTCCTTACAGGCTTTCCACGTCAAGCATAGTGTGACAAGCACGAGGCCCACGCCAATGCTG
ACGCCGATGATCACCGTCTTCGAGCCGCTGCTTCCGTCGGAGCTGTCCTCATCATCGTTGTAGCCGTAGCTCCCGTCTGTCCAACATGAGTCCATGCCAT
CAGCACCAATCTCACCTCACTAGCTCTCACATTGCACCGTACAGTGGTAGTCGTAGTCACCGGTCGTGTTCGAGTAGGTGCCGTCCAGAATGGGCATCAA
GCCGCGCAAATCCACGCTCTCCTCATGTTGCGTGGCTCTCCTCAGTTGGGGCTCGGCGCCTGCGTCCATTGCAGCTGCTGCACCATTCAGTAAACCCAGC
CAGGTGGCGACAATGACGAGCGACGCCAAGGTCCACAGTCGCCTCGCCATCGCTGCGACTGCAGCAACGTCTGTTGCTCCTCTTCGGCGACTCGTTCCGG
CCGCTCTCCGACCGCGTGTCAAGCTTCCTGCGGCGTCCTCTGCTGGTGCATCGACGACCTGCTTGCGCATGTACAGTCGACTTGCTGATTGCAGAAATGG
AGTGACGAGCTTTCGGCCAATCGCGTTTCATACAAAAATCAAGTGATAACGATTCGGATTTTCACGGAACTGTAAGTCCGCCGCTCACACGTTGGACTCA
GACAAATCCCGGCGGCAACCGTATCGACACCAAGCATCTCTACACAACACCAAAATAATATTTACAGCTTTTTATTCCTCTTTGTGACCTCGCAATGGGC
CTCGCCTCCTCCTTCAGAGTCGCCGCCGTGCTGGTCGAACTGCGTTTATAATTTGAACAGAGAACGCCGTCGGCCGTCGGGATATGTTGCTGCCTCCGCT
GCGGCGGCCCGGCAACGGCCCACAGCGTCCGTCTCGCATATCACTCACTCTCACATACAATGGAAGCTCCATCTCCTCTTCTCCTTGGTAGCCACTGGCT
CGACGAATTCATTCTCACACGAGCGCGGCAGCACCCGACCTTCTCCCGTGTTGCAGTCTCTCCTTCGGTCGGAGAGTGCATTGGGGCTGGGCAGCCTAGT
AGGCCTGGCAGAACTTGCGCAAGCACCCCATCGTGGAAAGCACTGGGTCCGAGCGCACGATGTCGATGAACGTCTGCAGGCGGGCGCGGCGGGCGTTGAG
CACATGGTCCGTGAGCTCAGGCTGCACGAAAAGCACAGCGCCGCTCGACACGTGCGGCACTTTCACTCCGCGCGACGCCTTTTTCGCCTTGACCTCCTTC
TTCAGCTCGCGCTCGAGTTGCTTGAACTCGTCAAAGGTTGCAGTCACGTCCCACATGACCACGGGGTTCATGTGCTTCTCCTGGCCGGCCGACTGGGCAC
CGCAGTCCACGCGCATGACGTAGACGTCGCGGGGTTTGCGCTTGCCGGGGACCGCCTGCACGAACGCCTTGCCCACACGAATGTTCGCTTCGCCTAGGTT
CATGTCGACGCGGCGGCGCATGTCACCGGGCACCACATTGACCAGGAGGCGATTCTTGTTCAGGTGCGCCAGCACACGACGTCGGGCAGCCGGGGCCTGC
CGCTCCTTTCTCTTGGAAGCGGCCGCATCGTCTGTCTTGTCGACATGGGTGGACTTGGACGCAATAAACCCGCCGTCAACGCGGAGCAATGGGAGCGTGG
AGGCTGTAGCAGTCACCGGCTTGGCGATGTAGTAGTTTTGAACGGAGGCCGCGTTGCGTGAGGCATTCATGGACAGCATGGCGCAGCCCATGAAGGTGTA
AAAGCTGATGAGCCCGAACGCCGCCCCCCCTGCACCAGGAGCGTGAGCACGAACGCGAGGACGTTCCAGGCCAGTACGCAGGCGACATAGGTGGCGAGCA
AGAGCGACGCGGCCGAGCTGAGGGTGACGTCGAGGTGCACGAGCGAGTCGTAGGCGCTCGTGAGCACGGCGAGGCGGACGCCCGGCAGGTTGAGCACGAT
CGTGGGCTTGGCATTGTCGGAGCTCACGGCGCGGGCGCGGGTCTTCATGCTGTCTGTTGGTGGCATGGTGGCCTCGAGGGTCTTCGCAATGGCGCGAAGG
AGTCGTACGTTCAGCGCTCGCAACTGAGCCCAAACGTTGGCGCCGGCAGGCAAATGCGGCTCACAGCAGGAGGCCTGGAACGCTGCTGTGGCGTGGGGTT
CTTCTGCGTCTGGAGTGCGCGAACTGGCTGCGTCTCCTTCCGCCCTGTTGATGGCTCTCCTTGGCACTGGCCTGTTTTTTTCGGAGTGAGCGCGGGGAAA
GACGGCGGCTCTGCCCTGCAATGTGCACAAGCCATGTTGATGAGCTTGTCGATGAGGAGCGGGTTGCGAGTCACTCTGAAACTGGCTTCAAGTTCAACCG
CTCCGCTTCGCTTTTGATGTGAGACCTTGGTAGCGAGAGGAAGAGTGAGGGCTTCACGGAGCTTTATGTTGGTGCTGCCAGCAGTACACATGGGCTGCGC
GCTGATTAGGCCACTGCTGTGAACCTCGCACGCAACAGCATAATGCCCGACCACCACATGGATTCTCCATCCCTCCACATGGTGTCTGCAAACCTGGCCA
TGCTGTTGCTCTGCTACGTTGTCAGATAGTCCACACCTGCAAACCAACACTCGAGTACATTCACATGAAACATTTCCATTTCCCCTTGACCTTCCTACTT
GAGCCGCTGCGCCGTGGCGGCCAGGAGCTGGCTGGTGAACTCCATGTCGGCAGTGCGGACCGTCAGGTCCACGAAGCCGCCGCTGCGGATCTTCACGTGG
AGCAATCCTACGTGCTCCGAGTTCACGAGACGGCAGGCAGCAATCGCTTCGTTGGCTGGAGAGTAAGCAAAGTGACAATGTTAGAGCTCGGCCACACAAC
GCAGAATAAAAGAGTTATGCGACGTACTGGTTGGGATGGCTTCGACGGTGTGCACGTTGAACTGGTGCATGCGGCCCATGAAATCCTCGAGCGTGCGGAT
GCCGCTCGGGTTCACCTTGGTCTTCTGCTCGCACGGGCACGCGCCCCAACGGCCGCCGAAGTCCTGCGTGGTGATCTGCCACGGCTCCAGCTGCCGTCCA
TTGTACTGGAAAACGCCGGTGCTGCTGCTACTGCCACCCAGAATATCCAAACCATTGGCAGGGCTCTTGCCAAGCTCAACGGCAGCTTCACATACAAACA
AAAGCAAACCAAGCCATTTAGCAACCATCCACCATCCTGATGCATCAGAAACCTTTCCTAACTTACCATTCATGCTTGAGCCGAGTCCAGACATGTCGAA
CGGATCCAAAGAAGCAGAGGGGGCCGGCGAGCTCGCCTCGCGGGCCGGTGCTGGCGCTAGCGGCGAACCCATGCCAAACGGGTCTGCGTTCATAATCGGC
TGCTGTGGGGGCGGTTGCTGGAACATGCCTATGTTTTGCGGGGCTGCGGGTGCGTCAAACGAAATGTCGAGCAGGTCCATTTCGACCTTCGGCTGCTGCG
GAGGAGGCGCTTGCTCCACCGGTGCTTGAGGTTGAGGCGGCAGCTGCTGCTCGTTGCGGTTCGATGAGCGCTTCGACGACGAGCGGACCGGGCGGCGACT
GGAGTTGAGGGTTGAACGCGTACTTGATCCCACGCGACGAGCGCCAGGCATCGGTGCCGGGGCACCAGGAATGCCACCAAAGATCGCGGAAGCCAGGATC
TGTCGCTCGTCAACGTTGCCATTAGATTCGTCCTCACTCGTAGGCTCACCGTTATCGTAGCTGTTCGGGGCACCGTACTCCTGCTGCGGTGGCTGCTGAG
GAGGCTGAGCACCGTAGGCGGGCTGACCACCATATCCACCCTGGCCGCCATACGCATGTTGGCCGCCGTATGCAGCCTGACCGGGCGCGGCTCCCTGATT
ATACGGGTCGGAAGGATAACCTCCAGGAGCGCCGGCACCCGGAGCTCCGGGAGCTCCGGGTGCAGCATTATCGGGCGTATTGAGACCAGTAGGACCCCAC
ACGTTCTTGACCACGCCGCGCTTTCCAGCGCCAAACCCTCCAGTAGGATCAGGGCCGCCAGAACTACCCAAGCCAGGCATACCACCCTGTCCACCATTAC
CACCCCACTTGTTGACACCAAAGGCGCCTTGCTGGTCCGCAGGAGGGAGCTTCGTCGGGTACGGGATCTCGGGCTTCTTGTAGGCCTCAAAATTCAAGCG
GTTCGAGTCACCGCCATTGCGACGGTGGCCGTAACCTTCATCCTCGTCGTCCGAGTCCTCGGGAGGGTCGTAGAGCGGTGCTCCTTGAGCCGCTGCCTTT
TCGACAAAACTGGTAAGGAAAGAAAGGTTGGGATCAACATCAATGTCCTCGCAGCTTGCATCTTCCGGGAAGACCTCATTCATAAGGGAGAAGTTCTTGG
TA