Description :
From Genome Similarity Track
Location :
Scaffold_129:30181- 33273
Transcript NameFunction/comments
Hyaar_Emoy2810533isoleucyl-tRNA synthetase
Hyaar_Emoy2810534hypothetical protein

Sequence
3092 bases(100 bases per row)
ATCAATGCAAAACTCTCCTGCAATGCAGTTGCAATCAAATAGCACTCTCTTGAGTCCACATGACAAGGACGTACGATCACGTACTCGAGCTCGGCATTGA
CACACAAAGCCTGATTAGACGGGATCGTCCACGGGGTCGTGGTCCAAATCACTGCTGCCAAGTCCTGCTTGTACTTGTCAACCACTCTCGCCAGTTCTTT
GCTTGTATTTGTACCCATTGAAGCAAAGCGGAACTTGACATATGCAGCTTGAGACACATGATCGTCCTGGTACTCCAGCTCTGCTTCAGCTAGTGCTGTG
CGGGAGCTCGGGGACCAATGCACGGGCTTGAAGCCTCGATAGATAAGTCCGTCCTCCACCATCTTCTTAAGTACGTCGTACTGCCGCACTTCGTAGCTGG
CAGTCATGGTCAAATAGACACTGTCTTGAGCTCCCGACCAGTCTGCCAGCACGCCCCAGCGCTCGAACTCCTTCTGCTGTTCCTGTACAGCCTGGCGAGC
CAGTTGACGAGACAATGCACGCACTTGAATCGGGGATAACTCGGTCGCTTCAACTTGCAACTGCTTTAGTGCCTTGTGTTCAATAGGAAGTCCATGACAG
TCCCATCCAGGGACAAAACACACGCGCTTGCCTCGCAGTATTTGATAGCGGTTTATTATGTCTTTCAGTATTTTGTTCAAAAAGTGACCCATATGTAAAC
TCCCATTGGCGAACGGCGGACCGTCGTGCAGCACGAACAGCGGCTTATCGACCGACTGGTTCGCGTAGGCGAGCGATACACAGCGCGCATGAAGCTGCGG
CTCCCGCACGGCAGCATTCGCGCGCATGGGAAAGTGTGTAGACGGCAAGTTGAGCGTCTGGCGCATGGCCGCCGCCATTGCCTTGGCGTCCGTCGCTTTC
GCCATCAAAGCGCGTGTTGATTGGCGACTGCGTACTTATGCTATGTTCGGTTTTCAGTGTAAAAGGTAGATATGCCCATACATCGATATAACACCGGTAT
AACCATTCAACACAAAACCCATGCTATTCACTTTTACTCGGTATTTAGTCAATAGTATTATTACTATTAAGAAACACACTGATGTCGGTAGTCGAGGAGA
CCATCGCGCAGCTCTTGTCTGTGCATCTGGGGCTGGTGAACATCAACAGTCTTCCAGATGACAGCATCCGTGACTTCCGAGACCTGTACCGTCTCCCCCT
GCGCTCTTTCCACGACAAATGCCATCTCCTGAGCGCCGCCGAGGCCACCGGCTGCTCGGCTGTTATACTTGACGTGCTCCTCTTTGTATCGGAGACCATG
GCGCCTCCTTTGTTTAGCAAACAGCTGGTCGCGTTTCCGTTATCACTAAATCAGTGGGTTTACTATTTGGTCGAACAGTGTATGGTCACGAATGAAACGG
TATCGCTCGGTGCACTACGAGGACTACTGGACCTTTACGCCGGTACAAACCGGTATCGAGAGCTCGCTGCCATGCTCCTATCGCTGGTTTTCTATGATAA
AGAGCCCAACCGATCTCTTAAAGTGACCGATGAAGTTCTGGAGATTTCGAAGCTCTATCGCCACCGGTTTCCAGTGGGTATTTTGGAGTTGCTGGACGAG
TACGTGACGCTGACCAAGCTGCAAATTGAGACGGAAAAAGAGGACGTTAATACCGCCCCGGAGGTGTGTACGAGACAAGCTTATATGGACAAGCGGTCTC
GTGGCGTGAGTAATTTGCAGGCCAATTGGAGGATGCGGTCTGTGCAGTTGACAGAAAAGGAGATTGTGTACTATAAACACGAAGGCAAATTGGACTGGTC
GGGAAAAAAAGCACTTCTTATGGACCAGACGGAGAAAAAGAGCAAGAAGAAGGGGAGTTTAGTCCTGACAAGAGGGATGCAGGTTGATACGCTGGACTAT
CGCGGGAAGTTTTCATTACGTCCGAGTTGTGTCAGAATTTGTGACGCAGGGGGATCGGAACAGTTGATCTTGGATGCTTTCACGCCCGAGGGACAACGTC
AGTGGGTGGCTGCAATTACTTGCAATGTGAAGCGTCTTAATCTTGATCCACGTTGGCTGGCGTTTCCGCGAAGGTGCGTGCACCGCATGACTGTGGGTGA
GTTCCTGCGCTACTCGATGCTTTACCACGGCGACGCCAGCAAGTCCCACACACGTCATAGCTCGTGTCAACCAGGACTGCTCCGCGAACGGTTTAAAATT
GATCCGAAGCGCTATTTATTCTCGGCTCTCTTGACCTGTGCTTTGGTGCGTGATTGGAAGACGATGGAGGAGCTCGTGCAGCCGCGTAGTGCCAAATCGG
CCATCGTCTCATTATTTTTAGGCGGGAACAGTGGAAAAGTGTCAAGGGCTTCAGGTTCGGCAGTATCATCAGCGTGGAGCTCGACATCCACTCCTGCCCC
ATCTCCCTACTCTGTATGGTCGGGCAGCACTGACGCTGCGTCATCCTCATCAAATCGGCCGTCCGCATCATTAAATAGTGCTCCTTCTCGGCCTGTACCT
ACGGGCATGACCGAGGTCCAGGCAATGGTCGACGCGAGTGCTATCGGTTACGGAGCCATCCTGGATATTGCAGAGCATAGAAATGCCCCACCAAATTTAC
TGGTGCTGTTGGAATCGCTGCATGAAAAGAATAGTGCTAAACGGGAACGTTCCACCGGCTGGGCCTGTCGTCGAGACGTGGATGCCAGCGATGCTGCATC
TATGAAAATCACCATTGACATTCCAGAGAGTGTTCGTGTGGATACAAGCTGGGACTGATGAGGAACCCATGTCAATACGGTGAGAGAACGTGGATTTGCT
ACTTTCTTATCTGCATGCGACACCACTATTTGTTTGTTAAGGTGTTGTTGAAGACCCGTTTTTACGTGCACAGTATACCCGCTTGTTTTTTCGTCATAGT
GGACGATGATGGAAAAGCGCAAATTTTGCATGATGTCGTGATATGCCTTGTGGGTTACTGTGGCTTATCGAGCGAGGTTGACTTGAGTAATCCAACCACT
ATGGTCAACCTATCGGATCACACGTCACTCCTGTGGATTGCACCGTGTTGCAGACTCTTGGCTTCGTAAATTGTGGAATTTACCCCAAACAA