Description :
From Genome Similarity Track
Location :
Scaffold_845:3018- 4966
Sequence
1948 bases(100 bases per row)
TGGAGGAACCAGTTTCGTCCTTCGATCACCTTCCACCCTGGGTCATCTCTTCCACGCTTGTTTGGTAAGTTTTTTGATCGCGCGTAATTTCTTTGGTCTA
GTCCCATAACGAGAGCTCTCAATATAATTTCATCTCATTTTTTATTCCATCGCTCCCATAATTCGTTTTTCTTCCTTCTTTTTATTGTCTTTTCATTGTG
ATCACACCATTTGGTCTGCGATTATCGCACTCAATTCACATGAATTCCATTCCATCTCCATGTACAACCTCCTTGCACCCATAACTCTCCTTCTCGTCTA
TGAATCTTCCCTGCACAGACACACCCACTCAAGCACTCCGATCGCTGCTAATCTCTAGTTTCTTCGTGAGATTGCGTCACATCGAAACGGTTCCTGTTTA
CACGATCGCGTTCAAACACTTGCAATATAGCTCCACAATTTAGATCAGCTTCGTCGATCTAAGTTGGGTGACTGTACTCCTTCCATTGTACCAGGTACTG
CTTCTGTATTCGGCCATATCTCGACCTCCGTCCCGACCGCACATCGATAATCTTATCCACTTTGAATCCGTCTGCGTCCAGGTCACCCTCCCAACTATCC
TCTGGCAACAGTGCTTGGTCAAAATCAAATCTGTCTTCCTCATCCACATTCAGCCTACTCGTAGGGCATTCTGGGATACGAGAACTTGCTTCAACTAGGA
AACATGAACCATTGGAAATAACCGGCCCGGCCTACCCGCGATTTGCAACCTTATGGCATGATTACCGCACTTTTCGGCCACTCGAAAGAGTCTATGCCAC
ATATTGACTAGCTTCCGAGCGTATCCTTCCTTGTCTCGGTCCAGGTATAGCCAAACCCTTGATCGCGATCAATATCCAATATATCTCGATCTTCATTATG
TAGATCGGCTCGACCTTTGATCACAACCTCCAATCGTTCATTCACTACTGCCCGTGCACGCCGATATTGGCATTGTATGCCATATCTCCACCTTCGTGCG
TCTCGATCTTGGAATTTAGTGCTTCCCAACGGTAAGGTGGCTTCCAAGGTTGATCTTGGGTCCCAACCGTGAATCAGATAAAACCGTGTGTCTCCACGAA
TTCGATCATAAGCGGTGTTGATCGCATAATTCAATCACTTTGTGTATTCGTCCCAGTCCTTGTGATTTTCATCCATGACATACATCTTGATCGATCGAGT
CAGTGTCTGCACCATGCGTCCGGCTGTACCTTTCGGTTGCGGTCTATATGCCATTAGGCTCGATGTTTTTTTACCGCGATCCGATTGAACGCTCGGAAGA
AATCGGACATAAATCCCAGCTCGCGATCATGACGTATCGCCTCACTCGCACCGAATCGTCTGAACACGCATTTCTCGTAATTTTCCGCGATCTTCTGAGT
GGATTTGGACGAGCTTGCTTTCGCGATCACAAAACCCGAAATTAGATCAACCCACGGTAATAGCTCGGTGTTTTTTTTAAAAGATCGTGGCAAAGAAGAT
ATGAGATCCATAGCTATAATCTGAAAATGGTACGTCGATTGCAAATTACCAGGTGATCCACTCCGATCACCTGGTCGTCCCTTTACTGTTTCATAATCCA
CACACTCTCCTACATACCGTTGCACACTTCGATACAACCCACGCCAATGAAGGTTCGCTCTGATATGTCGATCAGTACAGCCGATTCTTTTATGAACACC
CTCCATACTTGTGTGGTAGTGGTGCAAGAAATCTGTAACTGCTCTGAAACAACCAGACGGGACAGTTCAGTACGGTCCTCCGATTCGGTGGCCGATCTCG
GACAGTAAAATGGCAATCCACTTTGGTCTACTTCATAATCTGGTTCGATCAGAGAGAAAACTTTGGTTTTAGTCGCCGACAATCTAGCCACATCTCCAAC
CAGATATATCTTCAGACTGGATATTAAATTTTCTTCGTCTTGTGCTTG