Description :
From Genome Similarity Track
Location :
Scaffold_126:3018- 4236
Sequence
1218 bases(100 bases per row)
CTGCAACTGATCGAATTGATACCTGTTATATCGAGATTGGTATCAAGCACCAGGGCTGACATCGGACTAGCCACTCCCATCGTGATCGAGCTGAGATAAC
TCAACCGAGAGTCAGTCTTACTGAGATACAATGAATCAGCCATTTCAAGGCTTAGAACATCTGTGCCTACCGCATAGAAGGTTGGGTTAAAAATATTCGA
TTCTTGAGATGGTGGCCGAGCTGTGAAACCCATTTTTGTTGGCGAGTTATATATCACTAGATATATATACTTTCCACAATGGTTAATAGGATTGATAACT
GGGGAGCCGCTCTCCCGAAAGAGTTCCGCTCAGACTCTCTCGGCGATATTAAGCAACTCGGGATTAAAAAGCTCTTCCGCGGAATCATCCTAGCTCCCAG
CAACGCAGGTAAGACGAATCTATGCTATCACATCGTCAAGAACGCACCAAACGTTTTTAGCCATCTGCATCTGATTGCACGCAACCAGGAATTGTACAAT
TATATGAAGGAGAAACTTGCGGGCTATATCACAGTATATGACCCATCGACACCGCCAAGCGTCGATGATATCCAGAAGGATCCGCGAGGTGGTATTCAGC
TCGTTATCATCGATGACTACAGCTCGGACAAGAAGCTCCAAAAAGACCTATTCAGTCATTACTTCATCAGAGAGCGCCACAAGCGGCTATCTACACTGTT
CCTGACGCATTCATGGTTTGCTACTGACAAGCTAATCAGATTGAATTCAGAGTACCTCTGAATTCTGAAAGCAAACAGCCGACGCGATCTGAAGATGGTC
ATCTCTGATTTCAGTCTTCCCGGTCTTACGCTCGAGCAGCTAATTCGAGCCTACAATACGGCCACTAGAGAGAAAGGTCAAGCATTGCTCGTAGATAACG
TTAGAAGTGTTCTAAGGTATAATTTCAACGAGAAGCCGATCTATCTAGATTAGCCTTTGGCAAGAGGCGCGAGCCTCGAGCCAAAGGCTCTACCAGGGTA
ATAATTAATATCGACCGAATATTATAAATATTGACATATAATCAACCATGTCAAACATTATTACTCTCAGTTCGCAGCACATCGTCCCCAATTCATACAA
CAACACCCTGCGCTATGAGTTTCCCGGAAGCAGCGTTAATTTTACTAACAGCGAATTGGCTATTCACTCAATCAACATGTACAACAGTCAATTCAATATC
GATGCATCAGCATATGGA