Description :
From Genome Similarity Track
Location :
contig_38:301792- 317194
Transcript NameFunction/comments
g8754.t1hypothetical protein
g8755.t1XP_009515485.1 hypothetical protein PHYSODRAFT_551932 [Phytophthora sojae
g8756.t1hypothetical protein
g8757.t1ETI37614.1 hypothetical protein F443_16384 [Phytophthora parasitica P1569
g8758.t1hypothetical protein
g8759.t1hypothetical protein
g8760.t1ETI37633.1 hypothetical protein F443_16387 [Phytophthora parasitica P1569
g8761.t1hypothetical protein

Sequence
15402 bases(100 bases per row)
GCCGCCTCTCCAGCAACAGGAGACGAGATAAACCCGACCGAGCTGAGGAACATTCTGGGCTCTGAAGAGGAGGAGACGAAGGAGGACGAGGGGTCTCTAG
CAACTGAATCAACAGCCTTGGCCGCCGCAGCTGCAGCCTCTGCTGACAGTACCCCATCGGCCTAAGAACACTTGTGAATGAGTAATCAGTAGCGACAGCA
AGTATCTTGCCACAAACATGCATCTCAAGTGACTTTTTCGCCAAATACATAATTTATTTCAAATATTGCGGAGCTGACTCGCAACTTGCTGGGAAGCGGT
AGCTTGCACAAATACTTGCTCGGACTCCCAGCTTAAAGGCGGTGCTGACGGTTGGTACTCATGAGCGAGAGGAATGGGATCAATCGTCGGCAGCGGGTCG
TAGTTTGTGACCCCCAGCAACGGCTCTTCCATGTCGCTCTCCATCATCGTAGCGCTCGGAACGCGCGCCATCTGATGGTGCCGCTGCTTCCGGAGGCAGC
AACGGCGGTACAGGAAGCAGAAAGAGGTAGGAGCTGCACAAGAAGACGGCCACGAAGCACACGAGCATAGCATCCGCCCACTGCATCCGCTGGAGCCGGG
CGCTCTGCTGCAGCGAGGAAGGCGCGTCCGTGTCGATCCACATCTTGAAGCACGAATTGGCAATTGAGTTTTCTCGCACAAATTTTGGGTGGGACCAAAA
CTTGGCAAAACTCAAGTCGCCGCGGACAAGTACCATAAGTCATATTCGAGCTGCAACGTACCTTGGCATCCAAATGATCAATGGTTACGAGTGCTTGGGT
GGTGCAAATGTGACGGGTTGCGGCACGATGGACCCTCTAATGCGCCTTACATATTACGGATCGTGATGCAATTGACCAATGCACGATAAACATGTGCAAA
TTCACTTCATTAAAGCGCACAGCAGACAGAATTACATCCATGGTCTTGTCACTTAGCCACTGGGCTGCCCACCACCTGGTCCATGAGTGAATTCTCGATA
AGCTCCTGGCTGGCCGTGATGCTGTTGGCAGCAGCGCCCATCATGAACTTGGTCATGGCTCCCATGACGGGGGAGTCTTTTTCTGGTTGCTCTTGTCCGT
GCTCGAGCGACACCAACGAGCACATCTGAAGTAGACACCGCGGGCCGACGGACTGAGAAGGAGGCACTGATGAACGCTTGGCGACAGCATAGCATTGGTG
GCGGTGTGTCAGCCCTGCGAAAGGTTCGTCCACCACTTCCAGAGGAGTTTTGATCGAGATAAACACCACCACAACACGGTCCTCCTCCACGTAGCGGCGA
AGAACTTGCTTGACACGGAACATAGCGTGCGTCGAGCCAACGTACATCTCCTTCGCGAAGTTCTCGACGATTGTATCAGATTCGTCCATGACCTACAGTG
CACATACAAGTTCCAGGTAAGCAACGAAACTGATGCTGCTAGCAGCGACACTGTACCTTTGCAGTCTTCTCGTACACCTTGCCTCTGTGTTTGTCAGCGC
CCTTGAAGTGGTCCCATACCGCCTTTGCAGTGGTGTCCATATCAAAAGGAAGCACTTTGTTGGAGAAAACGTCCAAATAAATGCCATCGTCTCCATCACG
CATTTGGGTGTCTTTATATGTGACCTCCATCGAGTTCAAGCCATTTGTGCAGAATACAGCATCCATCTCGCGGTATGCACCCTCCAAAATCACAAGCATA
TCTTCAAAGTCGCCAAGATCCGACTGGTAGTTCACCATACGACCTACCGCGAAATCGGTCGTGTCCGGCGACACAGTGCGAGAACACTCCATAAGCTGCA
CAATCAGCACGACTTGACGTAAGAATCCAAAACAACTACCAAATACAAACAATAGCAGCCGCCATTACCTGATTCTTTGCTCGCTTGAGTAGCAGCATCT
GCATGCTCTTGGCAGCTTTGAGTTGGCTCTCCAGCACGAGTTTCAGCCTCGCATTCTCGATCTCTGCTTTCTCCCTGCGCTTGCGTTGCTGTTGTGCCAC
AGGCTTCCACACCGATTGTTCTGCAACGGACGAGGGCACCAGGGCGCCATCATGGCCCGCACTTGCATCTTCGTGCCCATCCTGCTTGATCAGCTTCACG
GACGTTCTGTGCTGCTGCAGAGTGTCCAACTCGGCCTCCAATTGGGCCACTTTCTCCTTCAAATACGCCACCTCAATGCGGCGTTCGTTCCTGGCCCGAT
TCGAGTCGCCAGTCACCCAACTCTTGCGCAGCAGCTTCTTGGCCGTCGATCGCCTCGGCGCTCGCGTGCGCTTGGGCTTCTCGCGCTCGATACGACGTGG
CGACCCGTCCTCGTCAGTCGTTGTGTGGTGGTTCTCGCTGTTCGACGCCGGTGACGACATTGCGTTGGGGTTCTGAGGCGACGAAGCAACCGACGAGGGC
GAACCCGTGGAGCTCGGGAAGCCCAACGCCCACTCCATCTCCTGCTTGTTCAGCACCTCTAGGGGTTGGATGGGAATGGGCGCGTCGCCGTTGCCGTCCG
CGAACTCGTCCACGAAGGACAGTGCAGCTTCGAAGGCCGCCATCTCGTCGTCCGCCAGGAACGCCATGGCATGTGCTTCTTTGTCGACGCTGTTCAATAC
TGAAACATGAATTGATTGCTGAATTCCGCTGGTGCAGGTTTTCGGTCAATGGCAGGCTGTCAATGATCTGGATATCTACCAATGAGTGCATTGTTGGACC
TAATTGTTGAAAAAGCAACATATCCGCACTGAACCAGGACGCGGCATGGATCGGAGAATCTGGTTTGAAAGTGGACGTGAAGGAAAAGTATTAGTACGCG
CGTAGGAAGCCTACCGTCCAGACGGTTGAAAGCCGCAGGTCGTCGTGGGTTTGGCCGCCGCAGTGCTGCACAAACTGCTGACACAAGCACGCACTAGCAG
AAAGCTGCATGCTGCAGCATGCTGTATTGGTTGCACTGCATAATGATGCGACGAGCTCTCCGCGCAGCATTCTGCTACGCACTGCACTGCGTAGGCTGCA
TACTATACGCAATATTCAATTGATTGTGTGCTGATAGTATAATGGGAACGCCTGAGGTTGGAGGATCTGAGGGCTGTGAGGGTGGGCTGGCGTCGTCCAC
TCCGAAGGACAAGTTAGGCAAGCCGGTGGGTATAATGAAGATATGTATTAAAATATTAAGAAGGCTGTACAGGTCACAGTGTGCAATGACGCCGACGCCG
CTGTCTTGGCGGAGTAGCCATCACGTGACTACCTAGACCAATTGAAAAAGCAAGCGCTGGATATGGTTCGGGTATCATTGGCGCCGTCGCCGTCTGCCAG
TCAGCGCTAGACAAGTGGAGATGGAGACATGAGCGTGGAAATGATAGATGAGTCTTTGGTTGATACATGAGTTTGTGGTTGTCGAGCAGAGTGGAAATGT
ACATGTCTTTCAAACTCGTTGACAACGGGAGACCGTTGCACTTGCGGTGGGCTTGGCCAATCAGGGTCCGGCCATGTGGTTTTGCCAAGCAAGCAAGTTC
AGAGGCGCCTCATAATTCAAGCGGCGGTACGTCGAGCGAGTGCGTCGAGTGTTTCCAGACCATAGCAGCATCGGACCCAATGACGGCAGCTGTCATGTTC
GCGGGCGTGGACATCGGGGGAACGGGCGTGAAGGTGGGCGTCGTCACGTCCGAGGGCTGTGTAGTGGCGCGCGAGCAGAAGAAGTACCACCCGGAGAAGC
ACGAGCCGCAGGACGTCGTGGATCTTGCCGTCTCCGTGCTGCATCAAGTGCTCAAGACGGTGCGTGCGTCGAAGTTGATGGTAATTAGAGTGAGGTGTCT
CACCAGTCGTCTACCTCATGCTGGCAGACGCGATTGGGATTGGGGGACCTGGAGGCGGTGGGCGTCGGCTGCCCCGGCGTCCTGGAAGCTGGGGGCGTCA
TCCACGCAGCTGCCAACTTCCCGTTCTGGTTGGATGTGCCGCTCCAGCAATTGTTCACCGACACCCTTGGCAGACCGGTTAGTGGGGGGTGTTTGGGTCT
GTGGCTTGAGGAATGTTATGGTGCTGACCGAAAGTGTAGGTTACTGTGTGCAACGACGCGGATGCTGCCATTTTGGCGGAGCAGTGGGTCGGCACAGCCA
AGGGTGGCATCAAGGATTTTATCATGCTCAGTGCGTGAATGTCGTGTGGCTTTCTTGGAGAAGGTTACGATAGGCCTGTATTGACCGGCTGATTTGGGTG
TAGCACTTGGTACGGGTGTAGGATTCGGTGTCGTTGCGAATGGCCAGCTTGTGCGCGGTGGAAGCAATGCCATTGAAGGGGGTCACATGGTGCGAAGCTT
GCTAGTATACGGGTTAAATTGACCGCTTGTCGTAGCTGAACGTGTGCGCTTGTCCTTGTAGATTGTGGAGCGCAATGGACGACCGTGTGGTTGCTCTCAA
AGAGGTTGTCTTGAAGCTTACAGCTCGGCGGGCGCATTGATGTCGCAGGCTCAAGAGCACTTGCGCGCTGGTATGATGCTGGAGCTGTGTGTTGATTATA
GGAAGTGAATACCTAACGATTCTGTCCACTGTGTTTGAATTATGTAGGAAGGGATTCGAGTCTCGCCAAATATTCGGAGGAAGATATTAACGTTGAATTC
GTCTTCAAGCATGCCGCCGAAGGCGACGAGCTCTGCAAGCATCTGATTGAAGAAGTAAAGTATGGCTGTGGCACCGCCTTATGGTTTGACTTACTAAGTG
ATGCGAAACTAATTGTACAGGCTGCCGACTACTTGGGTTTTGCCTGCGTGACCTTCTGCCGAATGTTAGACCCGGAGGTAAGGATGTTCAGCCATGGAGA
CAGTACTGCAGAGATAACCCTGTTTCCTTGATTGTGGCAGATTATTGTTCTGTCAGGAGGAATTGCCGAGGCTGGAGAGACCTATGTTGAGCAAATTCGT
CGTGCCTACGCGAAGCACACGTGGACTAAATTCCCCAACCCGGTACGCTTGGGCTTCTCGTTCCAATATCTGTTTCGATGATGTCTAACTCGTGTTTTAT
GTTATGTGTATAGGTTCGTATTGAAAAAGCGAGCGCGGGGTATGATTCGGGCATCATTGGTGCCGTTGCGGTATGCAAAAATCAACGCAAATGGCAGTGA
AGCTTCGTACGGTGTCGTATGCAGGCAGATGAGTAAGAAGTCCCAGCTTCAGATATCGATGATAGTTGAATGAAGTCTCTGTTTGATGTAATGCTGGGTT
TATTTGATGATCGCGGAGCGGCAAGAAACAAATCACTTTCAGGTAGTGTGTATCGAAGGAGATGCCGCATTTCCTATCTGTCCTGAAGGAGCAGCTAACA
ATTGCCAATCAAGCTAGTCACTGTCGCTGTCGCTGATGACGGGGCTGGCATTACCGTCGTTGTGTAGAACGGGGCTATCACTGCCATCGTTTTTGCCGCC
AGCGGGGCTGTTCGAGATCTCCGGTGAGCTTTCAGGGGGAGGTGTGTTTGCCTTGTTTTCCTCGTCAACAGAAACAGGCGATGATCGCTTCTCTCCTGCC
CGTCGGCGCTTGAACTCGCGCACACTCTCATCGTCATCAAGCTGGTCGTCATAGACTCCTCCGCACTCGAATAGGTCCTGGGTACGACGGTCTGTTTCGA
CTTCTGAGTAATCCCGACGGTAGACAACAGCTCCGTGGCGACGTTTTTCCTCTCCAGTCATCTGCATACAGGAAAGCAGGTAATCGTCAGAACAGCAGCG
ACGCGAGCCCCAAGAGCATGAACGCACATACCTTCGTCTTCCTCAGCTGATGCGGTTCAGAACGTCACTGTATGTGAAATGGTCGGACTCCGGGTCTAGC
ATGAACATAACATGTTGTGACTCCCTCTGAGGCAGCGAACACCAATAAACAGAAATAAATCAAAGTGAGCACAACAATTCAGCTGAAACAGAATCAAAAT
CGCCAACGTACGCTATCAAGCGACTCCACCGCCATAAGATACTCGCGGAGGTACGAGAATTTCTCGCGATCGCTACTGTCCTGTGGTAGAAGAAACAATT
CACCCATTAGCTTGTGCCGCGGTGCTTTAGTGCATACATAACAGGGGTGTACCTCTTCTTCTGCCGATCCGTTGGGCAGCAGGATAGAGCCCTGAATAAG
CTCCTTGCCAGCTTGGGTCTTCTTGTTTACGCCGCACAGCAGTGCACGATCCTCGCGGCTTGTGATTCCCTTGCTCTTGACATCTTCGGAAGGAAGAATA
TCGTACGACTGCAAGTCCACAGAAATTAGTATCCTGTCAGCTTGTGTCATAACGCATACCGAAATTCCGCTGCGAGCAGACGTACCAGAATTGCATACTT
GTTGGCAGACAAGAGCTGATCGGGGAAGACATCCCACACCTTGGCGATTTTTTTCCTTTTGCTGTGCGGGTGCACCAACAACTTTGGATCGTTAATGTCG
CGGAAGGACGCTTCGGCACGGTCCTCTAACGTCACGGACACAACCTCGGCCAGCGCATTCTCCGTGCCCTCACGCAGTGCACTCTGAATTTCTGCCTCGC
TCTTGAACTTGTGCACGGAATCGTACAGATCGTTGCCCATGTACTCCGTGCGTCGCAGCCAGGAGACTGTGGGGCGCACCTTAGATCGGCCCTTGGTGCC
CATATGGTCCTCCTTCATCATCAGCGCCTGCTCATCGCCAACCTCCAGCGGCTCGGGGTCCGTCGGGGCTGCAAAAATCCATCCGCGACATTTTAGCACA
AAATTCTACATCCTAATCCCCCAGATAAGAGTTCTACCTTCATATTTGGCCGGATCGATGAGGTCGATGGTCAGTCCGAGGTTCGGCTCCTCGTGGATCT
CGTACGTGTAGTCCATCTCGAGTGTGTTGGGCTTGTACTTGATGAGTCTGTGCACATAAACCACCACCACATCATCAGCTTCTCCACCTTTCTCCCATTC
TGCAGCTCGCCACTGTCGCACCGTTCCGGCTCGTGCGGGTATTTGACAAACTTGGTGTCGAACGGGATGTCCGGCAGCGAGTTGCGGAACTCGAGGCTGG
CCAAGAACTCCGACTGCTTGCCCAGCAACGCGCGTCGCTTGGCTTGCGCGTGGCTCTCCAGGATCATGCGTGTGTGGTCGCGCCGCGCTTTGAGTTTGTC
CTCCTTGTACTTGGCCACCTTCTTGCGCTCCAGCTCATAACGCGCACGTTCCTCGGGTGTGGCATTGGCACCGGGGGGCGCCCGCCTTTTCCGCGCCTCG
TCCTCCTCGCGACTGCGGCCGTTGCTTTTGCTAGCCGCCGCGCCGTTGGCCTCCGTCGCTGTCTTCACCTCCGCCATCGCTCGAAGCTCTTTTTGCTCAC
TCCCCCTAAACCGAGAAATGTGGTGGAGTCTAATTTACGTGGTGCACATCATCATATTTTTGTCACTTCAAACGGCGTTTCGCGCAACAAATGGGCTGTA
GCCGACTCGCCTATTAGCCATGAAGCAGCTGCTGATCCTGGTGGCGCAGCACCCGCTCAAGGTCGGGTCCGTGGTGCTGCTGCTCAGCGCCTTCTACAGC
TTCGCGCGCGTCCTGGTACTACAGTACGTTGTGGGCTCCGTCCAGGACGCCATCGTGCGCTACCCGAAGAACTTCCCGCACGCGTTCTTCCTCCCGCTTT
TCCACGTGTCGCTGGCGGTGGCTGCTGCTGCTGCATTGTATCAGGACTATTGCTACAATCGCTTCTGGAGCTCCTCCACACCCACGCAGCTCTGGAAGCA
CGTGCTGCCCCTGCCGCTCACACTGCACCCCGGCAAGTGGAGTCGGTTGGTTGGCATCCCTTTGTACGCGTTCGGCATTGCAGTTTTGGAGGCTGTGCTT
GTGTTCAGGGACCCTACCATAGAGAGTGTGGCCAAAATGGTCACTAGAGTTTTGTTGCAGCCGCCTCGAGAGGAGGGGCAGGTACTCATGCCAAAACACG
TTGCAGGCGTGCTTTTTCAGGATCAAGCGGAGGTGGCCTGGAAAATACTTACAGGAGGTGCAGCAGCTCAGAAGTCATCGACGCGTACGTTTTCGTACGT
ACGACTGCTCGTTGAGATCTTGTTGGCTGCGGCAGTTTGTGTAAGCTTCGCTCTTGCGCGGTTCTTTCGAGAGCCTCAACACGGTACGTTGCCGCTGCTA
TTGCTGGGTTAGTTTCTGTATAACTTACGCCTTGCGTAAATACTTGTTGCATTGGAGTGATTAGATGGGGATGAACTGCGCGAAGCTGCGAGAAACAATG
ACATTCTAGGAGTGAAGCTACTTCTTGCTCGGGGGATGGACCCGGATGCTTGCTCTGGTGATGGCACGACGGCATTGCACGTCTGTGGGCAGCAAGCAAT
TGACAGGGCCGCGCAGATTCTTCTTGAGCACGGGGCAGACGCGAACGTAGCTGATCGACTTGGATTTACGCCACTACATTGGGCTGTACAAATGCGACGA
GAAGAAGTGTCGACTTCAAGCCGTTTGGCGACGATTCGAATACTGCTGCACCATTGCGCTGACCCACGCAAACCCGACTCAAACGGCACAACGCCGTTAG
TAATTGCATCACGAAAGGAGAACGAAGCATCGTTGGGAGTGCTAAAGGAGTTCTTGCCTGAAGGTGAAACTGGTGGAGAGGTAGAAACCACCGAAACGAT
AGACAACGCCAGCGTGGACTTGGCAATTCCGAATAATTAGCAAAATTACCACTCATCGACTACTAAATCCCGTGACGTCCATCTCTATTACCTACCGTTG
ACACCACAATCATAAGGTCTGCGTTAGTTCAATGTAACCCAAACGCACGATGCCAAAGCACGTACCATTGACAAAATCCTCTCTAGCTCTGCCTTAGAAG
GATAGAGTGGTAGATCCAGCCTGAACCAGCAAGGCAGTGGTCAACAAAGCGGCTTGCAGAAACACGGTTCAAAATATGCACTCACCTGTTCAAGCACGTA
CTTGCATGCGGTAGTACGGTGTACACGGTTGAAATATCCTTCCCAAGCTGGATTGTGAAAAGTTGGATCTCGCCATCCATACCAGTCAGACCCTGTATAT
TGAAGGTCAGAACCAAATTCACTTAACGCGTAGTGAAGCCGAAAAATATACCTTAAAGCCTTCGACAGGAACGCCGCTGGAACCAGTGACGTACTGCAGC
AATCTTCCGCGTTGATCTTGCGTGAACGACTCTAGAATTTCCCAAAACCAGGCAACCAATTCAAACTCGTGACTACTTTGTTCGTAGAATCGAATATCTG
TGTGCTGTCTCCAGTCATTGACATCGATTTGAGGTAATCCAGAGAAGAGTATGTCAAGTTCCTTGAAATCAAATACGTGAAGAACTGAATCGCTGATGAC
ACTGCGCAGACCCTCCATGATGCTCGAAATTTCCGCTCGAACACTGTCAAACAGATAGTACTGTGCCACTTTTGCAACGTAAAGCTGTTTGTTTCCATCG
TGAAGAATGACATCGGCGCCATTTGGAATAAGTTCTGCGCCATCCACCGTGAAGTTCAAGCCGAGAGCATTTGTGTTATCGTTTTCGAGGATCCACATCA
TACTGGAATGCACCGTTTCATCGAGCAGATATAGGTCTGAGAGCTTGAGTGGCACGCCGAGAATGTGCTTCAGCAAAGGGACGGAAAGCCGCACGTTTAG
AAGTAGGCCTTCAAGCAAAGCCTTCCCCAATAGCTTTCCGAAGAAGACGTACATCTGTTATTATGAGCATCAACCACAGTTAAAACAATTTGTGATGAGC
AAAGAGGCAATGCTTTGGACATACCTGCAGCTGCTTCGTGCATTTCCCCGTCGCAGTTCGATTAATCCAGTATCCCTGGTGCGCTGCTGAGCTGGTTAGT
GTGAACAGCCCCAGAGATTCCGCAAAAAGCTGGCTGCAAACAAGATGCAGCCACTCCCGCAAAATGCCACCACCATCGACGCCAACCTCATCCATAAAAT
CGACGCGTAGTCGGCGATGTAGAGTTGCATCCGGTGCAGACATAAAGAGAGTCATTGACTGCTTCAACACCCTGTCACGATGAATGCCTGCAGCTTTCGT
CAGTTGAGCAACCTGAAAATCACAGCCACAGCTAACGTACGTATAGTATGGTAGCCATCGACAATGGACGAGCAGAGCTTGAGCGAATACTGGTAGAACC
ACTGTGCTTTCTCGGAAAATGGCAAGGTCGATACTCGCTAAGAGAACCGCGCACAAAAACATTAGACAAGAGTGATAAGGCTTACCCGACCGACTGGCTT
ACCATGATCGTTTTGGAGTATGGTCGTGATGAAGTTGAAAATTCCTCGGCTAAGCGCCAGCGCACAGTTCGGCTTCCCGAGTGTGAGTCATCTCGCACGA
ATGCAGTTCCTGGGGTGAGCCAAGAAAGTTGTTTCCCACTGCTGTCCGAAAAGATGACAGAGGAAACAGACATCCTCGAGGACCCAGGCACCTGTGGAGG
GTGTTGTATTTCCCATTCCTGAAAGTCACGCTCTCTAATAATGACGCTGCATAAAGCCTTACTCACTTGGAGAGCTTCAAAAGGAACGTTTACCTGTAAG
ACCCAGAGTGCATAACATTAGCTATACAGATCATTATCGGATCCGAAACTTTTCACCCCTTACCCAGCGCACATGTTGCCCTCCAATACAGCGCTTCCAC
TGATGCCGTTCGCGTGCAATTAACTGACGGTCCGTCAAATCTTCACTAGGAAGAGCGTTCAGACCTCGAATCCAGGCAGCACGAGGAGAGGACATGAGGA
GATAGTTCGAGGCCGAACGCTGGCTGATTTCACCTTGGGGAGCGCTCAGTATGGAAGCACTCGCATCTTCCTGTCGACTTCTGATCATCTTTAGCTCTGC
AATCCACGAATCCAGCACATCAGATCACAGGTAAACCATGAAAAACAAATTCAGCTTTTTCAAACCTTCAGCCGTAGTACCGCACAACACACAGTCGGTC
TGCGAAAACTCGTTTGTGTGGTAGCAGATCTCGCATCTCCATCCAGCATTTCTACAAAAATGCCACGACACCGGAAAGATATAAATCCCCGATCTCACTT
GATCCCCAACGTTCAAAAAGACTCACGATCGTTCGATGAAGGCGCGGTGGCGCGACCGCCGGCTCGAGCTCGTGCAGCACTCCTTACAGGCTTTCCACGT
CAAGCATAGTGTGACAAGCACGAGGCCCACGCCAATGCTGACGCCGATGATCACCGTCTTCGAGCCGCTGCTTCCGTCGGAGCTGTCCTCATCATCGTTG
TAGCCGTAGCTCCCGTCTGTCCAACATGAGTCCATGCCATCAGCACCAATCTCACCTCACTAGCTCTCACATTGCACCGTACAGTGGTAGTCGTAGTCAC
CGGTCGTGTTCGAGTAGGTGCCGTCCAGAATGGGCATCAAGCCGCGCAAATCCACGCTCTCCTCATGTTGCGTGGCTCTCCTCAGTTGGGGCTCGGCGCC
TGCGTCCATTGCAGCTGCTGCACCATTCAGTAAACCCAGCCAGGTGGCGACAATGACGAGCGACGCCAAGGTCCACAGTCGCCTCGCCATCGCTGCGACC
GCAGCAACGTCTGTTGCTCCTCTTCGGCGACTCGTTCCGGCCGCTCTCCGACCGCGTGTCAAGCTTCCTGCGGCGTCCTCTGCTGGTGCATCGACGACCT
GCTTGCGCATGTACAGTCGACTTGCTGATTGCAGAAATGGAGTGACGAGCTTTCGGCCAATCGCGTTTCATACAAAAATCAAGTGATAACGATTCGGATT
TTCACGGAACTGTAAGTCCGCCGCTCACACGTTGGACTCAGACAAATCCCGGCGGCAACCGTATCGACACCAAGCATCTCTACACAACACCAAAATAATA
TTTACAGCTTTTTATTCCTCTTTGTGACCTCGCAATGGGCCTCGCCTCCTCCTTCAGAGTCGCCGCCGTGCTGGTCGAACTGCGTTTATAATTTGAACAG
ACGAACGCCGTCGGCCGTCGGGATGTTGCTGCCTCCGCTGCGGCGGCCCGGCAACGGCCCACAGCGTCCGTCTCATTCACTCACTCTCACATACATGGAA
GCTCCATCTCCTCTTCTCCCTTGGTAGCCACTGGCTCGACGAATTCATTCTTCACACGAGCGCGGCAGCATCCGACCTTCTCTCCCGTGTTGCAGTCTCT
CCTTCGGTCGGAGAGTGCATTGGGGCTGGGCAGCCTAGTAGGCCTGGCAGAACTTGCGCAAGCACCCCATCGTGGAAAGCACTGGGTCCGAGCGCACGAT
GTCGATGAACGTCTGCAGGCGGGCGCGGCGGGCGTTGAGCACATGGTCCGTGAGCTCAGGCTGCACGAAAAGCACAGCGCCGCTCGACACGTGCGGCACT
TTCACTCCGCGCGACGCCTTTTTCGCCTTGACCTCCTTCTTCAGCTCGCGCTCGAGTTGCTTGAACTCGTCAAAGGTTGCAGTCACGTCCCACATGACCA
CGGGGTTCATGTGCTTCTCCTGGCCGGCCGACTGGGCACCGCAGTCCACGCGCATGACGTAGACGTCGCGGGGTTTGCGCTTGCCGGGGACCGCCTGCAC
GAACGCCTTGCCCACACGAATGTTCGCTTCGCCTAGGTTCATGTCGACGCGGCGGCGCATGTCACCGGGCACCACATTGACCAGGAGGCGATTCTTGTTC
AGGTGCGCCAGCACACGACGTCGGGCAGCCGGGGCCTGCCGCTCCTTTCTCTTGGAAGCGGCCGCATCGTCTGTCTTGTCGACATGGGTGGACTTGGACG
CAATAAACCCGCCGTCAACGCGGAGCAATGGGAGCGTGGAGGCTGTAGCAGTCACCGGCTTGGCGATGTAGTAGTTTTGAACGGAGGCCGCGTTGCGTGA
GGCATTCATGGACAGCATGGCGCAGCCCATGAAGGTGTAAAAGCTGATGAGCCCGAACGCCGCCCCCTGCACCAGGAGCGTGAGCACGAACGCGAGGACG
TTCCAGGCCAGTACGCAGGCGACATAGGTGGCGAGCAAGAGCGACGCGGCCGAGCTGAGGGTGACGTCGAGGTGCACGAGCGAGTCGTAGGCGCTCGTGA
GCACGGCGAGGCGGACGCCCGGCAGGTTGAGCACGATCGTGGGCTTGGCATTGTCGGAGCTCACGGCGCGGGCGCGGGTCTTCATGCTGTCTGTTGGTGG
CATGGTGGCCTCGAGGGTCTTCGCAATGGCGCGAAGGAGTCGTACGTTCAGCGCTCGCAACTGAGCCCGAACGTTGGCGCTGGCAGGCAAATGTGGGTCA
CAGCAGGAGGCTCGGAACGCTGCTGTGGCGTGGGATTCTTCTGCGTCTGGAGCTGCGCGAACTGGCTGCGTCTCCTTCCGCCCTGTTGATGGCTCTCCTG
GGCGCTGGCCTGTTTTTTTCGGAGTGAGCGCGGGGAAAGACGGCGGCTCTGCCCTGCAATGTGCACAAGCCATGTTGATGAGCTTGTCGATGAGGAGCGG
GTTGCGAGTCACTCTGAAACTGGCTTCAAGTTCAACCGCTCCGCTTCGCTTTTGATGTGAGACCTTGGTAGCGAGAGGAAGAGTGAGGGCTTCACGGAGC
TTTATGTTGGTGCTGCCAGCAGTACACATGGGCTGCGCGCTGATTAGGCCACTGCTGTGAACCTCGCACGCAACAGCATAATGCCCGACCACCACATGGA
TTCTCCATCCCTCCACATGGCGTCTGCAAACCTGGCATTGCTGTTGCTCTGCTACGTTGTCAGATAGTCCACACCTGCAAACCAACACTCGAGTACATTC
ACATGAAACATTTCCATTTCCCCTTGACCTTCCTACTTGAGCCGCTGCGCCGTGGCGGCCAGGAGCTGGCTGGTGAACTCCATGTCGGCAGTGCGGACCG
TCAGGTCCACGAAGCCGCCGCTGCGGATCTTCACGTGGAGCAATCCTACGTGCTCCGAGTTCACGAGACGGCAGGCAGCAATCGCTTCGTTGGCTGGAGA
GTAAGCAAAGTGACAATGTTAGAGCTCGGCCACACAACGCAGAATAAAAGAGTTATGCGACGTACTGGTTGGGATGGCTTCGACGGTGTGCACGTTGAAC
TGGTGCATGCGGCCCATGAAATCTTCGAGCGTGCGGATGCCGCTCGGGTTCACCTTGGTCTTCTGCTCGCACGGGCACGCGCCCCAACGGCCGCCGAAGT
CCTGCGTGGTGATCTGCCACGGCTCCAGCTGCCGTCCATTGTACTGGAAAACGCCGGTGCTGCTGCTACTGCCACCCAGAATATCCAAACCATTGGCAGG
GCTCTTGCCAAGCTCAACGGCAGCTTCACATACAAACAAAAGCAAACCAAGCCATTTAGCAACCATCCACCATCCTGATGCATCAGAAACCTTTCCTAAC
TTACCATTCATGCTTGAGCCGAGTCCAGACATGTCGAACGGATCCAAAGAAGCAGAGGGGGCCGGCGAGCTCGCCTCGCGGGCCGGTGCTGGCGCTAGTG
GCGAACCCATGCCAAACGGGTCTGCGTTCATAATCGGCTGCTGTGGGGGCGGTTGCTGGAACATGCCTATGTTTTGCGGGGCTGCGGGTGCGTCAAACGA
AATGTCGAGCAGGTCCATTTCGACCTTCGGCTGCTGCGGAGGAGGCGCTTGCTCCACCGGTGCTTGAGGTTGAGGCGGCAGCTGCTGCTCGTTGCGGTTC
GATGAGCGCTTCGACGACGAGCGGACCGGGCGGCGACTGGAGTTGAGGGTTGAACGCGTACTTGATCCCACGCGACGAGCGCCAGGCATCGGTGCCGGGG
CACCAGGAATGCCACCAAAGATCGCGGAAGCCAGGATCTGTCGCTCGTCAACGTTGCCATTAGATTCGTCCTCACTCGTAGGCTCACCGTTATCGTAGCT
GTTCGGGGCACCGTACTCCTGCTGCGGTGGCTGCTGAGGAGGCTGAGCACCGTAGGCGGGCTGACCACCGTATCCACCCTGGCCGCCATACGCATGTTGG
CCGCCGTATGCAGCCTGACCGGGCGCGGCTCCCTGATTATACGGGTCGGAAGGATAACCTCCAGGAGCGCCGGCACCCGGAGCTCCGGGAGCTCCGGGTG
CAGCATTATCGGGCGTATTGAGACCAGTAGGACCCCACACGTTCTTGACCACGCCGCGCTTTCCAGCGCCAAACCCTCCAGTAGGATCAGGGCCGCCAGA
ACTACCCAAGCCAGGCATACCACCCTGTCCACCATTACCACCCCACTTGTTGACACCAAAGGCGCCTTGCTGGTCCGCAGGAGGGAGCTTCGTCGGGTAC
GGGATCTCGGGCTTCTTGTAGGCCTCAAAATTCAAGCGGTTCGAGTCACCGCCATTGCGACGGTGGCCGTAACCTTCATCCTCGTCGTCCGAGTCCTCGG
GAGGGTCGTAGAGCGGTGCTCCTTGAGCCGCTGCCTTTTCGACAAAACTGGTAAGGAAAGAAAGGTTGGGATCAACATCAATGTCCTCGCAGCTTGCATC
TT