Description :
From Genome Similarity Track
Location :
Scaffold_40:301790- 308991
Sequence
7201 bases(100 bases per row)
CTAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGA
AGTTCGTTGCCATGGACAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCCGGA
GAGCCTGGTGGTGTCAACACCGGCCGAGCAGCCGAGCGCGTCAATGCGTTTGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACGTGCAGG
TTCCGGCGGCGGAAGCAAATCTTCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCAAGAACCTTCACTTCTGGGTCCG
AGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCAACCGAGCAACTTCGTGCTGCTTTTGCACTCTCCAACCTTAGCGGCCGTGCTAAGAGTTGGGTG
TACACACGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGTGAACAGCTCCGAGCCGTGTTCCTCCCGGCAAACTACGAGTACCGCC
ATCGTTCGCGCTTCCTCTCGTACAAACCAGGGAGGCGTGAGCTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCTACT
CAACGAACACATCAAGATGACGGTGTTCATGGACGGCCTTCGAGTAGGCCCCGCACGCACTCAGCTGTCCCGGGTGCAGTCAAACACCCTTGAAGAGGCG
ATTCAAGAAGCTCTTCAAGAAGCGTACAGCCATCGCCAGGCGCGTACGTCGGCCTCAGCGTGGCCTGGGAGCTCCATGTCGACTCCCAGTCGAACGAGCT
CTAACGGACCAGTCCCCATGGAGCTCGGGTCCGCCGAACAGCATGACATCCGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCAAGCGCGACTGTCCCGC
GGAAAGACTCCGCAGACGGTCTTTCCCCAAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCCGGAAACCAGTAGGG
GCGGGGCGCCCTACTGGGAAAGAACTAAGTCTTCGTGATGGGTGCGCGGGAGGCGCGTACCATGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAAT
CGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTAGACGGTCGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATCGATTCTGGGGCGTCGAAGAATTT
TGCACGCCGCCAGACGGTTGCTCGTAACAGCAACAAGCTGTCCGATGCTTTGAGAAAAAGCAAGGACAACGGGACGGTATCAGTGCGACTGGCCGACGGG
AAGGTCGTCACTGTTCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATTCATATG
ATATGATCCTAGGCATGCCCTGGCTTGAGAAGCACGAACCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGC
ATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGGCGTA
TATGACGACTCCGAGGAAGTTTTGATGGTGGCTGCGCCCAGAAGAGGCGCCGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGA
CAGCTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCATAACTGAAGAGGAAGGCGTTGA
ACACGCTTCCTGGGTGGGTAACACAGTGTCACACGCGGTCGCCCAGACCTTAGCTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTAACACAGTG
CCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCACACGAGGCCACGAGTGCCTCGGATG
TCGTAGCGACGACATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGC
TTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACGTCTTCGATGGCGAGACAGGTTTACCCGTCAGGGCA
TCTGGTGTCCACTTGGAGCCGTTGCCAGAGGTTGCAGAGATACTGCACCTCGAGGAAATGACGGCTAAGTCTTTCCTGACCAATCTCAAGGCTAGAGATT
GCTGAGATGGTACTCATGAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACATGAACAAGCAGCGTC
AGGCGCGCTTGGGTTCTGAGATTCTCAAGAGCCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCTA
ACTCCCACCGGATCGAGGTGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAG
GTCATCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGCGGCGAAATCCCCACAATCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGC
GTCTAGCTCATGCTTATAACAAGCCGAACAACGCGACGGTGCCGGCCCAAACACCTATCCCACGAAAGATGTGTTGTAAAACACCGTGGCCGGGAGCGTA
CTGTACAGTGCGCTGGATTTGGTAGACGAATACTATCAGATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTGAGCACTCCAAGCGGCATGCTTT
GGGAGTGGCTCGTCATACCGCAGGGCCTGTCTAACGTCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTTCGCCCTATGCGTACCTTCGTACAGAC
GTACTTCGACGACATATTCGTCCTTAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTGGGGAACCTCCGTCGAGTGTTGGACGTAATGTGA
TCAAACAAGCTCTATGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTTGGGCTGACC
CAGACAAGGTCAAGGCCATAGCAGCATGGCCAACGCCCCGATCCCAAAAGGATCTTCGAAAGTGGTTGGGCTTGACCAACTACCTTCACAAGTACAGCGC
AGGGTACACGGGCTTTGCTAAGCCCTTGTCGGGCCTCCTTCAGAAGGACATCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGATACCATCAAG
TCCAGCCTCCAAGAGGCCTCTGTCCTGGCCCTGCCGGACGAGACGAAACCGTTTAGCGTCGTCTGCGATGCCTCCGATTATGCCATCGGATGTGCATTGC
TGCAGGCCGACACGGCTGGACACGAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGTCGAGCGGAACTACCCTGTCCACGACAAGGAGCTCCT
GGTGATGAAATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCCCGGCCCTTCGTGATCTACACAGACCACACGCCCTTTAGGACGGCGACTAAC
TCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAGCTTAACTTCCGCGTCGAATACAAACCGGGCAAGCTCAACGTGCTTGCGG
ACGCCCTCTCCCGGCGTCCTGACTATGAGTTGGCCCACATCACACGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGC
TGTCGCGCCTATCGTCAAGTTCCTCACGACAGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGCTGAAG
GATGGCCTCCTCTATTACCGAGTGGAGCCCAATGAACTTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGATATCCTCGCGGAAGCGCACG
AAGCGCCCTCCAGCGGCCACTTTGGCCGCGAGAAGACCTTTCTGTCGGGCTCTCAGGCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATATGT
GAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGTCTGCCCGTACCGGCTGACTGTTGGAAGTCAATGGGT
CTTGACTTCATCTTTGGGCTTCCCACCGACGAACACGGCAACACCGGAATTTTTGTGCTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCGGTTC
CCGTCACTGTTACGGGCGAGCAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGATGATTGTCTCGGACCGAGACCCGCG
GTTCCCGGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTAGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGCCAGACAGAGCGC
GTCAATCGAGTGCTCGAGAACATGTGTTCGCGGCAGCACCACGTACGTAGTCGACGTACCTTCCAGTTGTTGCGTTTGCGCTCAACAACGCGGTGCACGC
GTCCATGGGGCTCACGCCGTTCTACTTGAACGGCTTCCGTCGCCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTATAAGTGGGGGA
GAGGCTCGGAAAGCCCTTTCCTTGCAGGTCTCGGATGTGAGACCAGTTTTGCTGCGGAAACAAGTGGACTCCTTTATGGATACCAAGCTGAGCGTTGTCA
GCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAATGAGTACTCCGACAAACATGGAAGACGAAACTTAAGTGTATTTAAAGTGGGGGACTT
AGTGTTACTAGACACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCATTTGCAGTCCTGGCC
AGACATGGTGCGTCGTATACCATCGACCTGCCAAAGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTCTTAAGCGGTACTTTGATCCGCAGGGGG
TTGCTGACTTGCAGACCCACCTTCAACCAGCTCCTCGAAGCGAGGGCCGGTCACAGACGTCGCCGAGGGCGTCGGAGCAGGTACCCAAGCCTCAGTCGGA
ACGGCAAAACTGCGGTCAAGACCCTACGCCGGAGGGGCTCCGTACGAACGGACCCCGGAGCCATACGCCGAGTACGCTGAGTACGTCGGGTACGCACCAT
ACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAGCAGAGCCTCGATCCGTCGGATCATGCGAAAGGCCTTGTCCAGATCAGACGAAGA
GGCCCGGCGATCCACCCGCAGATACAGGCTCGCGACCTCTCGCTCCAACAGGTCAGGCGACCCGCAGGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGG
CGGCAGCATCACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACATGTTGACGGAGGAGGTCAACCTCAGGGCCCTGTGTCGGACCCGCAGC
CGGAGCACTCGGACGAGAGTAGCGCTCGGGAGGTGCTGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAATCCACCT
CCACGTGGAGCGGATCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTTGTGGGAGCCG
ATTGAACGGCTCCTGATTGACGGCTCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGG
TACGGACGATGAATGCACTCCGTACCCGCACTCATCGTGAGCGCTGGAAGCCGCACACTTCAGGATGTCTCTTGGCAGCATGCGCTTGCTGACCAAGTAG
GCAAACCGAACACGAAGATCACGCTGGTCCAGGATGCGGGACAGCTGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGATTACTTGAGAGACTCTA
CCCACCCAGAACATGTCCTCACAAGAACCCCAGGTGGGACAGTTCTCGGGCATAACCCAGGGATATCCCCAAGAGGATAGAGACCACCCCGGGTCTCGGG
CTTCTTACGACAAGTCGTGAAGTCCTTAAGAAGGATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCAACGAACAAGTGTTCCTTC
TGAACAAGGGCACGCTCGTAAATGCCCCTAGAAGTGTGGTCGCCCACAAGGTTACGAGGAGCGACGAGAATCTCTAGGAAGAGGTCAGCCCCAGAGCTCT
CCTCGGGAGGCCAATACCCTCTTGCGTTTATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGAACCCCCACGCACACGCTAAGCAGCTTGGAACTCCTC
CTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGTCTCAACGATAGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCATCCTCATCATCCGAGGAGTCG
AAGATGTCCCGATGGGAGTGCCGAGTCTCCTTCTCCTCACGGAGTGGAGACCTAGAGGTTGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGTTTTAGAGG
CCTTAGCACGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCAACGCCACCAGCTTTGGGAGTGCCCTTGGCCTTGACGGCCGG
ACGCTCAGAGCGCACAGACGTTCTGGGGCTGTGACCATCTTGGTCACTAGCGAGTGACTGCACGTTGTCATCCTTGTGCTCACTGGGCACTGGGCTGTGC
CCTTCCGCAGAGCCCGCAGGAGCATCGTGCGTGCTCTCGGACTCGGCTTCGTCCTCACTGCCAGAGTTGAACTCACGCTCTACGAGCCGAGGGTTCGGAC
G