Description :
From Genome Similarity Track
Location :
contig_38:30174- 33157
Transcript NameFunction/comments
g8299.t1hypothetical protein

Sequence
2983 bases(100 bases per row)
GCAAGCTCCGGTTCCTGTTGATCGCTGTCGGCATGTACCTCAACATGATGTACAACGCGTACTTCGAGAGACCAAACAGGATCATCACATCTGACGACGA
TATGCTGACGTACGCTCTGTCTGGCCTCGTCATTGTGATCCTCCTGCTGTTGATTTGCTGCGGTTACATCGCCAGTCGCGTGACCAAGAAGATGTCGATG
AAGCAACGCAAGCTGCGCAAGATCAAATTCTTGTTGTCGTGCTGCTGCTTCTTTATCTCCATGCTGAGCCTCACGGTGTTGTCTATCGGCAACCTATTCA
CTATCTTCGTTCTGCTGTTCGTGGCGGTCTACTGGTTCATGCAGATTTGCATCCTGCGGCTGCAATACCACCACATCGTGGTGCGTGCGCTGGCGCGCGC
CTTCGACCGCGCAGTTGGCTGGATTGTGTTTGGGCCCATTATGATCGTGTCGATGTTCCTGCCATTCATCTCCTCCTTCCAACAGCGTGTCATGTTCAAC
AACGCCTTCACCTCGGGTCTCGAGGTATCGAAGCTCTTCGCGCACGACGTGGCACCGGCACAGGTTGTCAAGGTCAAGCGTGTTTCGAAGAAGAAGAAAA
GCCGCGACGACTAAGCGAAACCATTTGCTAGGACTTCTCTGTTGAGTTGATCGGTCAGCCAGTCTTGCTATTTTGTATCTTCATAGAAAACAAAACATTT
TGTTCTCGACTGCTTTCAACGCGTCTTCTGTTCTCTACATGAAATGCGAAGATTAGATAAGGGTGGCTAGTGATCAACTTCTTCTAACCTTGCATTCGGG
TGAGGTCCGGGGTTGAAACAACATGACGCATGCCAACGAGCTCTGCAGCCGAACGACTGTTCATCCCACTGTGCGGACTCACGACATTCCTTTGGGCGAA
TGGAGCAAAGCTGCCCGACGCACTCAAAGGAGATCGAGCGTTGTTGACGTGAGGTGGAGAGCCAATCTTGAGTTTGTCCAGAATCTCGGAAAACTTCTGT
GTGTCCGGCTGGAAGCGCTTCAGATCCAATTTTCGCCGAGAGTCTCCTGCCCCATTCGTTTTCCGAGGACCTGAACTCGAACCACTCCCACTATACTTGA
GCTCTATGGAAGACCGCGAGCGCACGGTGGGCATCGTCAATTCTTGCGAAGGTGACGAAGTGTCGCTGCCAAAATCGTCATCTTCTCTAAAATCTCCAGA
TAGTGGCTCGGTATCACTTTCAAGAGATGACATCGTGTTACTCCTGCGGCGGGCTCCGTTTTCGTCTTCTTCGGCCGACAGACGCGAGCTTCGACTACCT
GAGTCACTCTTTGGAGCAGCGGTTACCACGTTGGATGCACCAGCTGTCATCTCTCGCATGCGCATCACGTCAAACTCTTCGGCGTCAACTTCATTGTCAA
TTTCAATCGCCATTGCGCTTTCAGTATTTCCTCGCGACATCTGGGTAGCCAGGCTCTGGATGGCATCTTCTATCGCGTGCATCCACTGCTCCTGACGCCC
CCACGTGTCTGTAAGCACAATAAAATTCTTGTATCCCTTTGACGAAAACTGCAACCCGTGTGCACCACTTCCGGGGCCTTCTGTCACGCCGAAGCTGTAC
CACTTGCGAACGGATGTGGGGATAACCCACTTCATACGGTTTGTCCAGTTGGCGCTTTGAAGCGTATCACAGTACCAGAGCTTATCGCATACTTGGCACA
GCCCAAAGAATGTGATGGTAAACGTGAGGGCATGGAATGGCATTGGCACTGGGAACTGGATAAATGAGCTCACACGCGTGGGTTCCGGTATAGGAATATG
ATCGTGAATCTTGTCCTTCTTGTACATGAATCCAGTGATGAACTCGTCCGTATACGTGACCTTGCAGTAGTGGCTTGCTGCGCCAGAGAAAATGGTCTCC
AAATAGCCTGTGTATTCGTCCACATCTGCATTGGTGAGCGTGGCCGACACGTATTCGACTGCACTCTGCTTCAGCTTTAAACACCCATGACAGAGCGGCG
CGTTACGCTCACCGAGCGGCAGCATCTCGACACGGTTCTGCTCGGCAAGAGTTTGCTCGAACTTTACCCACTTTTGGTGCTGTGATGTATACTGCCGCAC
GACATCTTGACACGTTATCGCAACTGATCCGCTTCTGCAATTCGGGGTGCTGCAGCAATAGAAACGTTTTTGTTAGTGCACGCACGGGAATCTCAATATA
CCACACACAGTAGGTACGTACTTGGTCAGTGTGAAGATACTGTTTGCAATAGTGGTCATGTGACCCTTGTACTGTACGTGCTCTTCGTATGCACGGATGA
CAAAATCCAAAATGTTAGCCCCTTCGATGAAGAGGCTATTCAGCAAGGGCGACGAAGGCAACCGCTTTTGATCAGGATCCAACAAAACAAACCGAATGAC
GTCCGTAAGTTCGTGATGCAGCATGCTGTTGCTGGGGTGCGATCCATAGCACGCCAGCAAGCATGGCATTAAACCAAAATTGGCCAAGAAGTAATCAACA
TCTCCACTTTGCAACAGAACGCAGCGCTTGAGAAATGTGATAATGTGCAGAAGAGCAGACCCTTTGGTATTAACCGCCTTGATACTTCCTGGATTATAAG
AAGTTGACATTGTGCGAAGCTCGTTGACGTCCGACGTCACCACCGCTCGACACAGTTTCACAAATTTCTCCACGCGCGGGATTAAGGCACTCAGTACCGA
CACATAGACCGTTTTCAAAAGACCTTCGATACCTGTGACATCGCGCTTCTTCTTGTGATACCCCAATGTTCCCATCAGCATCATGACAATCGACAGAGAG
CCACCTTCACGGACAACGAGAGACTTACACCCTTGAGTACACTGACGGCAAACCTCCGCAAACCCCAAATCAATCAGTGTACCAAACGAAACATCCGACG
TATTGAGCAGAAAAATGAGCAGCGACTTGAAAAGTTCGTTGTGATGGAGAGGGAAGTGCTGATCCGTGATCAATGGCAGGAAA