Description :
From Genome Similarity Track
Location :
Scaffold_42:30172- 31327
Transcript NameFunction/comments
Phyke_g2236hypothetical protein PHYSODRAFT_245864

Sequence
1155 bases(100 bases per row)
TCCTCCATGCCCTCCACCCACCCCCACGCAATGACCGAGATGCGACCTTCCTGTCGAACAGGGACGTCTTGCAGGATGCCGTGGCGCCAAATAACGTTGG
TGTCCCTAGAAAATGCGTAGACACAGCCATCAGGCTGTGGCATGCTCACCACACTCTTCGTCTCGGCGTGCTCGAAGGCAGCATCGCGGGTTGCCCCAAA
GGAGATACCGACTGTGAAATTCTGGATGGCCGCGATATGGGGCTTCACAGCCGCGGCATCAAAGTGGAAAGGCTTCCACTGAGATGTGTCCTTGTACCAG
TTGAAGCGCGTCGCCTTGATGGACAAACTGAAGAAGCCCTTGACGCGGTCCAAGATAAGGTCAAATGTGGGGCATTTGGCTTTCCAGCTTGAGTGGTCGT
CCACGATGAGATGCGTGCCGTCgatcttgttgttgccgtgCCACATTTTGAGCAGCTGCTCACGCGGGATGCCGCAGTTGTCCAGCTCGCCCATCAGTTT
GGTGTACAGCTCACCCTTCTTAAAATCGCTGAAGAGGTTGggcaccagcaccacatcccGAGACGTTAGTGGCGTGGAGAATTTGTCGTCTTTAGAGCCC
AGATCGTACGTGACACGCAGATCCACAGGCTCGGTCATGGGCTCGAAGTTTTCAGtgttcttcttggtgacGCGGTTGCGCTCGtgtttctttttcttct
tcgacttcttgtCACCGTCTGCATCCTGCTTCTCCGCCTTGggcttcttctcctgttgctccttcttctcagcaGCCCAGGGCTTTCTCTCCTTTTTCAC
CTTGGTAAGCGGTTTCTTGTCCGCTTCGTCGCCAGAAGGAACTGCTACctcctccttggccttcGGGTCTGGCACCGTCACAAAGTGGTTCCTACGACAT
TCCTCGCCGAATCTGCACTCTCCAGTCTTCCAGAAGAATGGACAAAGCTTCGTGTCGTGCACATATTTGCAGCCGCGTCTAGAGcactttttcttctgca
tgaACATACGGCATACCGTCTTGAACATGCCAGCCTCGTCTTCATAGTGCGGCGGTGCCTTGGGTTTCTCCTTTGTCACTGGGGTCGCGGCCTCCACCAG
CGCCGCTGGGGCTTTAGCAACGTCTGTCATCTTATCGATCCGATCTTCGACTGCA