Description :
From Genome Similarity Track
Location :
contig_38:30170- 33153
Transcript NameFunction/comments
g8677.t1hypothetical protein
g8678.t1hypothetical protein

Sequence
2983 bases(100 bases per row)
GTGCGCAAGCTCCGGTTCCTGTTGATCGCTGTCGGCATGTACCTCAACATGATGTACAACGCGTACTTCGAGAGACCAAACAGGATCATCACATCTGACG
ACGATATGCTGACGTACGCTCTGTCTGGCCTCGTCATTGTGATCCTCCTGCTGTTGATTTGCTGCGGTTACATCGCCAGTCGCGTGACCAAGAAGATGTC
GATGAAGCAACGCAAGCTGCGCAAGATCAAATTCTTGTTGTCGTGCTGCTGCTTCTTTATCTCCATGCTGAGCCTCACGGTGTTGTCTATCGGCAACCTA
TTCACTATCTTCGTTCTGCTGTTCGTGGCGGTCTACTGGTTCATGCAGATTTGCATCCTGCGGCTGCAATACCACCACATCGTGGTGCGTGCGCTGGCGC
GCGCCTTCGACCGCGCAGTTGGCTGGATTGTGTTTGGGCCCATTATGATCGTGTCGATGTTCCTGCCATTCATCTCCTCCTTCCAACAGCGTGTCATGTT
CAACAACGCCTTCACCTCGGGTCTCGAGGTATCGAAGCTCTTCGCGCACGACGTGGCACCGGCACAGGTTGTCAAGGTCAAGCGTGTTTCGAAGAAGAAG
AAAAGCCGCGACGACTAAGCGAAACCATTTGCTAGGACTTCTCTGTTGAGTTGATCGGTCAGCCAGTCTTGCTATTTTGTATCTTCATAGAAAACAAAAC
ATTTTGTTCTCGACTGCTTTCAACGCGTCTTCTGTTCTCTACATGAAATGCGAAGATTAGATAAGGGTGGCTAGTGATCAACTTCTTCTAACCTTGCATT
CGGGTGAGGTCCGGGGTTGAAACAACATGACGCATGCCAACGAGCTCTGCAGCCGAACGACTGTTCATCCCACTGTGAGGACTCACGACATTCCTTTGGG
CGAATGGAGCAAAGCTGCCCGACGCACTCAAAGGAGATCGAGCGTTGTTGACGTGAGGTGGAGAGCCAATCTTGAGTTTGTCCAGAATCTCGGAAAACTT
CTGTGTGTCCGGCTGGAAGCGCTTCAGATCCAATTTTCGCCGAGAGTCTCCTGCCCCATTCGTTTTCCGAGGACCTGAACTCGAACCACTCCCACTATAC
TTGAGCTCTATGGAAGACCGCGAGCGCACGGTGGGCATCGTCAATTCTTGCGAAGGTGACGAAGTGTCGCTGCCAAAATCGTCATCTTCTCTAAAATCTC
CAGATAGTGGCTCGGTATCACTTTCAAGAGATGACATCGTGTTACTCCTGCGGCGGGCTCCGTTTTCGTCTTCTTCGGCCGACAGACGCGAGCTTCGACT
ACCTGAGTCACTCTTTGGAGCAGCGGTTACCACGTTGGATGCACCAGCTGTCATCTCTCGCATGCGCATCACGTCAAACTCTTCGGCATCAACTTCATTG
TCAATTTCAATCGCCATTGCGCTTTCAGTATTTCCTCGCGACATCTGGGTAGCCAGGCTCTGGATGGCATCTTCTATCGCGTGCATCCACTGCTCCTGAC
GCCCCCACGTGTCTGTAAGCACAATAAAATTCTTGTATCCCTTTGACGAAAACTGCAACCCGTGTGCACCACTTCCGGGGCCTTCTGTCACGCCGAAGCT
GTACCACTTGCGAACGGATGTGGGGATAACCCACTTCATACGGTTTGTCCAGTTGGCGCTTTGAAGCGTATCACAGTACCAGAGCTTATCGCATACTTGG
CACAGCCCAAAGAATGTGATGGTAAACGTGAGGGCATGGAATGGCATTGGCACTGGGAACTGGATAAATGAGCTCACACGCGTGGGTTCCGGTATAGGAA
TATGATCGTGAATCTTGTCCTTCTTGTACATGAATCCAGTGATGAACTCGTCCGTATACGTGACCTTGCAGTAGTGGCTTGCTGCGCCAGAGAAAATGGT
CTCCAAATAGCCTGTGTATTCGTCCACATCTGCATTGGTGAGCGTGGCCGACACGTATTCGACTGCACTCTGCTTCAGCTTTAAACACCCATGACAGAGC
GGCGCGTTACGCTCACCGAGCGGCAGCATCTCGACACGGTTCTGCTCGGCAAGAGTTTGCTCGAACTTTACCCACTTTTGGTGCTGTGATGTATACTGCC
GCACGACATCTTGACACGTTATCGCAACTGATCCGCTTCTGCAATTCGGGGTGCTGCAGCAATAGAAACGTTTTTGTTAGTGCACGCACGGGAATCTCAA
TATACCACACACAGTAGGTACGTACTTGGTCAGTGTGAAGATACTGTTTGCAATAGTGGTCATGTGACCCTTGTACTGTACGTGCTCTTCGTATGCACGG
ATGACAAAATCCAAAATGTTAGCCCCTTCGATGAAGAGGCTATTCAGCAAGGGCGACGAAGGCAACCGCTTTTGATCAGGATCCAACAAAACAAACCGAA
TGACGTCCGTAAGTTCGTGATGCAGCATGCTGTTGCTGGGGTGCGATCCATAGCACGCCAGCAAGCATGGCATTAAACCAAAATTGGCCAAGAAGTAATC
AACATCTCCACTTTGCAACAGAACGCAGCGCTTGAGAAATGTGATAATGTGCAGAAGAGCAGACCCTTTGGTATTAACCGCCTTGATACTTCCTGGATTA
TAAGAAGTTGACATTGTGCGAAGCTCGTTGACGTCCGACGTCACCACCGCTCGACACAGTTTCACAAATTTCTCCACGCGCGGGATTAAGGCACTCAGTA
CCGACACATAGACCGTTTTCAAAAGACCTTCGATACCTGTGACATCGCGCTTCTTCTTGTGATACCCCAATGTTCCCATCAGCATCATGACAATCGACAG
AGAGCCACCTTCACGGACAACGAGAGACTTACACCCTTGAGTACACTGACGGCAAACCTCCGCAAACCCCAAATCAATCAGTGTACCAAACGAAACATCC
GACGTATTGAGCAGAAAAATGAGCAGCGACTTGAAAAGTTCGTTGTGATGGAGAGGGAAGTGCTGATCCGTGATCAATGGCAG