Description :
From Genome Similarity Track
Location :
scaffold_10:301561- 302647
Sequence
1086 bases(100 bases per row)
AGGCAACTCCGACCCCCTGAACGGAGCTTCCTAGCTCATAATACAGCTTCTAGGGTTGAAAGATGCTTTGGTCAAGCTCCGTGTGTATTGCTTGGAGAGG
AGCGTTTTGTAATTTACATATCATGCCTCGCTGCGTACGACGACTCATTTATCGCAGAGACTGGCTCGGTGATTTTCTTTCTTTATGCAATACAACTTTG
CTGAACACTACAAGCCAGGCGAGACGAACAGACGCTGTCTAGACATTCGGACTATGACCCAAAGTCCAGGGGCGAAAACATGCATCAGTCATGTCGACGA
TGCAATATTTTCAGACAATCAACGTGCAAGCTATAGTGCAGTGCGCGAAGAAATTATCGAAGGGTACAAGTCTGATGAGGCATATTAGGACTTGTTGAGG
TACTTCGAAGATCCTTCCGACATATAACTGCAAGGTTTCTCCCTTCTCGCACAGGATCGCGTACTCATCGTTTTGAAGTTCATAAATAATTGTTGTAGTA
TGCGGCTGAACACGGAAATGCAGCAAAATTGAATTTCATTATGAAGGAGTTCTGCGCTGTCGTCTCTTACGAGTACCATGACAGCCTTTCAGGTGGTCAT
CTCGGGCACGAAAAGATTGATTCTCAGTCTTTCCCGGGATTGCTATTGGCCATACATGTATAGAAATGTGTGCGCAAGTATGTGGGGAGAGATTTTCCAG
AGAATGAGACCATCGAGTTCCCCTCGGACCCCACTTCGGCCGTTGGTAGTGTCAGTAGAAAGCGGACGTCTTAGGTATAGACTTCATATTTGGACCTCCG
CGCGACAAACATGGACGCAGTGGCATTGGGccgattgagcaagatgggacATCTTGCGTCTGTTTCGGATAAGATCTTTGCCGAGAATACAGTAAAGATC
TTTTTAGACGCTGTTTTCGTCTGGATAGCCTTATTGGGAATGTGTCTCCCCATGACGTCCGCTTCACGTCGGCGCGCACTGTTTGGACTAGTTGGCATTA
AAGTGTCCATGTCAACAGTGGCACACCCTGAAATGGACGGCCAAACAAAACGCATGAACCGAGTCCTGAAGGACGTACCACGTAGT