Description :
From Genome Similarity Track
Location :
Scaffold_254:30142- 37233
Transcript NameFunction/comments
Phyta_totarag6241phospholipase D; Pi-TM-PLD
Phyta_totarag6242tubulin-specific chaperone D, putative

Sequence
7091 bases(100 bases per row)
CCTGCCGCGCTGGTTCGTGCTCGCCATGCTCCTCAGTGTCTTGTGCACGCTGGCGTGGCTGACGCTGGTCGTGCTGGGCCCGCAGCTGGACCTGCACGTG
GACGCCACCGCCTACCTCTACGCCGGCGTTctcaactcgctgctcggcagcttcttgtccgcCAGCGGCTACTGCTGTCAGAAGCACGCGCATATCCGCG
TGGCGCGCAACTCGGCGCTGGGCACGGCCACCATGCAGACGGCCTTCCTGGCCGGCCTCTTCCTGCTGGCTGTGGGCACCATCTCGGCCGTCCTCAACCT
CGGGATCCTGGGACAAGCCGTGCAGGCGCCCTTCGCGGCGCTCACGCTGATCTACAGCGCGCTACTGGGGcgcttcgtgctgcacgagagcTTTGGCGTC
TACGACTTGCTCTCCAGCGCGCTCATCATCTTGGGTGTCGGCGTTGATGTCTACGCCGCGCAACTCGCGGACGTCCCGCAGACGTCGTACACGCTCAAGT
CGCTCGGACGGCTGCTGATGAGAGACTCAATCTTCCCGCTGGGATACACGGTCATGGCGCTCACGTacgcgatgctgctgcttcgacgcGTGCACacgga
caagctgcagcgccatccgATCGGACTGCTGGCCTTCAGCTCCTGTGCCGGAGTCATGGCAGgcttcacgtcgctggcTACCAAGTCGGTCGTGGAGGTG
ACCAAGACGGCGCTGAAGCACCAAGACTGGCTGGTGTTCCTGAACCcgttcttcatcctcctgGTGGTCGCCATCCCGTGTGCGCTGGTGCCacagctct
tcttcctgaacAAGGGACTCGAGTTCTTCGGCACGCTGAAATTCATCCCGCTGTATCAGGCTTTCATTATCATCGGCAACATGGGCTGTGGCATGGTCTT
TTACAATGAGATGGCCAACTACAGCTCGACGGCGCTGACGTACTTTATGGGCGGCATCATGATCACTATCTGCGGTGTGTGCGTATTGCTGGTTAAAGTT
GACTCTGAGAACAGCCGTGGAGACGGCCGACGCTCGAACGCAGTGAAGGCGGTGGATCGCCCGATGGATGAGTTGCTAGATCGCAAAAGCAAGGATAAGG
AAAGGTTCGAGACGGACTTCACGTTTGAGCAGATGAAGTGGGCCGCGGACAGTGACGGATCGAAGCCAAACGAACTGCGCGTGTGCCGCGACTTCCGCGA
GTGCCAAGAGGCCATTGTGGAGCTACTGGTATCCGCGCGCAAGTCGATTTACTACTCAACCTTCCTGTGTGACTTCACCCAGGTCCTCCACACTACAAAT
GAGGAGCACACCGGCAACACATTTGTGTCGCTTGTACGCGACGCCGTGAAGCGCGGTGTTGACGTGCACATCTTGTACAACCCAGTGCGTGACTACGGAA
CGAATTCAATTGCCGATCTGCGTCTCAACTTGCCTCAAGAAGTGCATTTTGCTTGCTCGGTCAGTGACCTGGGTCCGAGCTGGTTTACACGCCACTTGTC
CAACAACTCCAGGTATGCTTTCCACCACCAGAAGTATCTGTGCATTGATGAGGAAACCATCATGGTCACTGGCTGCGACGTGAATACTGAGCGGGAGGGC
TGGCTGCGTAAGAACCATCTTGGATACTATTGGCACGAGCTCAGTGTTATCTGTCGTTGCACGTCTGAGATGGTCAGTTGGATCCACGCTAACCACAAGC
CTGCGGAGAAGAAACGCTACTACGATCACTTCATGGAGTCCCCGCCGTTCCCGCTGGTATCCGGTGGTTGGCGAGAAGAGAATTGCATGGTCAATATGAT
CATGAATGCCAAGCACTCCGTGCAGTTGGAGAGCCAAATTATGATCTCGGGTGGCTCACTGCAGCATAATCGCATTTGTCCTGCGATTGTCGCTCGTATT
AGCCAGGCCCACCGCAAGAGCGAGCCATTCCACGCGCTAATCCTGACAAACGCGGCCCAGAAAGATGAACCATCATTTCTGGCACGAACCTACTGCACGC
TTTCCATCCAGTGGTCACTagagcagctggaggactGCGCATTAGCGTATGGCCTTACGACAGACGAGCTATGGCAGCACCTTCAGGTGGGCCGTCTCGA
GCATGACCGTGTGCTGGTCAAGGTGCATTCTAATATCCTCATTGTGGACGGGAAATACGCGCTTAGATCGTCGTCGAACCTGGCCGACCGCAGTCTGAGC
GCGCGTCCAAACGACACTGAGCTGGGCCTTCTCTTTTCGGGACCTCGTGtgaatgagctgcagcaagaccTTCTCAACATGTACTTGGGCACGATCGGCG
AGAGTTACTCGTGGAGTCAAGTATTCCAGCGTATCCGGGGCACTGCAACGAAAAAGCCAATCGGAGTGATTAAACCGCTAGAAAAGAAGTCATGGAGTCC
TGTGTTCACGTGGTTTATGATGAATGTTTTCATCTACCTCAGTGAAGGCGCTACAGGTGGCCGAGTCAAGGTAACCTACGAAACCACGGTCATTGGCGAA
GACAAGCATGAGTTCGAGACCTGAAGTGCGACGCACACACTGCTGGGGATATATGTACTTGGAAGTATATGAATGCTCTTTTGCAGGTTAAACTTGCTAA
TAGCCCATTTCTTTGATGAGGGTCTTGTAGCTTGCATCTTCTTgagtagctgctgctgacctcgcttcttctgcggGCACGGGCCTGCATAGTCGCATCG
ATTATGAACTGGTAGTTAGTATATGGCACACAACATTGTGTAAAACAGGACGGCAAACATACCGCTTCTTCGAGGGCAGCTCCATGTCTAAAAGTTCCAA
TAACTCATTTCGAGCGGTGCGCACTTGGGAAATCTGTAGCGTACACGGGACGAGTTATTAGCTGCTCGCCTCGAAGTGCACGGAGTTAGGACGTACCGAA
GCGTCCCATGCGGTGTCACTCAAGATCTCGACCACTCCGTCGTACTGCAGTGAGGATTCACGCGAAACAAGTTAGCTCCTGGATAGATGTCAGCACAGCT
GAAACACCAACCTTTTCTTCGATGACAATCTCGTCGTGTAGAAGCAATCGCGTGTAGAGCTTCTCGGCAGTCAGCTTGCGCACTTTTGGGAATTTGTGCC
CCAGAAACAGCACCAGAGCTCGTAAAGTCTTGATTTCAGTTTCGGGGTCACTTGGGAGTAAACCAATCAGCACGCTTATCGCAGCACTGAGTTTTGGGAC
TGCAGTACACTTCTGAATCTCGTCGCGCAGTACATCATACAGACGCCCACCAAAGTCCGTAGTTGCTGTAGCACTGCCATCTTCTGCCTGGCGTTGTTCG
AACAGAAAGCGCAGTAGGTTGGACTCCAGCAGAAGTGCCATCGTTTTCATAAGCGGAATTGTGACACGGTCATCCTGGTGGTGGCGAGTCAGCAATGTCA
CTAAGAAAAAGCTGAACCGACTGAGCAAGCCGAAGTCTTTTGCCTGCAAATGCGCGCGCATCCAATCAAAAAGGGCGCCCTTCGAAGCCTTAACGACACT
CTCGGTTAACCCACCCACACTGATGACGAGGCCCGCGGCAATTTCCTCCAAAAATTCTGGAATatccatcatcttcactACTAACGGAAAAGTATCGTGG
GCCATGGACCAGTTCACCGTCAAAGTCGAAGGAAAAGTCTGGTTTTCGAGGTGGAATCGATCCGGGATACCGTCAACGCGAGGGGAAGTTGAATGAAGCA
ATCGGAATAATATGTTTCCGGCTGTCATTCTCATGTTATCCAGCTTTTCAGCTAGTTGCTTGGCAAGGGCTCCAAACTATTAAACACGATAACGCAGGCA
GCAAAGTTAGCTTATACAAATAGTGAAAAGAGCATTCAGGAAACGTACAATTGTGCCCACAACATCGGGAGACAATCGCCGAGCAAATGGCATCAAGGAT
GTTGGACTTGACCTCGTGTGCTCTGCAATCTTCGTGCGATGCGCCAAGTCTGGGATGTAAAAAGCCCCACTTTCGGAACTCTGCACCGCTTCCTCTATTG
ACAGCCTTTTCGAGTGAATAAGACCTACTCCGGTAGGGCCGAAGTAGTAATAACCCAGAGCTGGCTTCTCAAATTTGACGTAGCATATCGGATCGAGTTC
CAACGCACCGCTGACTTCTTCGATCTTGCGCTTTCGATCTGATAACCCGTCAATAATTAATCCTCGGCCATACTCTGTCTGCGCAACCGCGCCCACAAGC
CGGAAGTGTTGATTTTGCACGTGTGTGATTTCATCAagtagcagcttctcgatACCAACCATGGCTTCTTTGCGGACCCAGGAGCCGACATCTCCACGCT
CATCTACTCGATAATCTTGATGGATACATCGGACGAGTGTCTGGACTACATCGTCTTCGAAGCCGTTAAGATCAAGCTCAGCTGATGGCCGAGAACTCAG
ATCCACCAGTGCTTGaactgcagccactcgacTTCCAGGATCCTCGTCTTCTGTAGCACGTTCCTCAAGTGAAACCGATCGAAGGACTGCAGCAAATACC
TCTTTCAGGCAAGGTTGGACTAATTCTTTAGCGGCAACACCTACAGCACGTAGAAAACCTCGCCGTGCAGCAACATTTGGATTCGGCACTTCGACGGGCA
CACCGTTCTCCTTGGATGCCACCATGATCCCAGAGTTGATGAATCGCGGTATCAGTCCCTGCATGTATTTTACGTGTGCTGGACTGCCCTTTGCAAATAT
CTTGGGACAGTATTGAGTAGTAAATGCACCGAAAGCATCAATAGCTGCATCACGAACACTCTCATTCGGGTGCACAAAGCATTCTTCAAGCATCGACAGA
TACTTCTTCACATGAGCAAATCCCAGACTCAATCGAGAATTTGAGATCACTTCAATCACATTGCACACAGTGGTCCGAATCATCTCACCGCCGCGTCCAC
GGAACAGACGCCGCTTATCAACCTCAATGGGCAGCATCTTGACCTTCTTTTGTAGCTCCCCGTCAATAAACACAGGGATCTGAGCCAGACAAGTGAGTAG
CTCCGCGATACTGATGACAGCACCATGTCGAACGATTACTTCGACATCTGGAGAGAGGGCAGATTCCAGAAGACGCGGAAACAAACGGGTCATGGCATTT
GGCGGGTCTATCGCCCCGATTTTACCtagcgcagcagcagcaagaccgCGGATCTGGGCATCCCAGTGAACAATTTTAGAGCTGATGAGGTGCTCTAATA
ACGGGTATCGATATTCCGGATACTTCGCGACGAAGACACTCACATCCAGATACGCGTGACGTAAATTTGCCACTGAAAAATAGTCTGCTTTGGTAAGCAA
ATCGATACCGTTTGGGAAATTTGTGCGTCCTTGCCGCCCAACGTTTTCTTGGAAAGCCGCTGATGAAGCACGACGGCAATTCAACTCGCGGTCGAACACG
CAGTTCATCAGCATTGCTGGTGCGAGGACTTGTTTCAGCCAAGGCAGAAGCAGAGATGGCTCGTACGCGCGTGCGAACGACCAACACGCGTAGCAAGCAG
CGTCACGGACATGGGAGCCGATACTGTATGTACCTTTTCGAATGTCGTACTTCAGTGCATTAGCCACACAGTCCACTGCATCGGGTAAACGCTGAGGTAG
CAAGACACCACGGCGAGCGAGTTCTGCCAGTGCCAGACTGGCGCCATGCCACGCACcgtcatcttcagtggcCACAAAAAGTTCCAGCACAGACTGAACT
ATATCGTCCGCGAACTCATACGGTAGGCGGCCAGTGATCCGCCCAATGCCCTTTGCTGCTGACCACCGCACCACTGTATCTTTGTCCCGCAATCCACACA
GAAGAACCTCAACtatctgctccagctcttccaccacttcaaaagcatcatcgtcgtcatcttcgtcattACCATTTGCATGGCTGTTTTGCGGGGTTGA
AGTGACAGAGTTGCTCGTAGCTAGTCCCAAAGACTGCATATTAAGCTCCAACGACCGCAGACCACGGCTGTAGCGCCATGACCGTATCTTCGGCGGCAAG
TAAAGTAGCCCAAGACGTTGCACAAGCTTGACGCTCAGTTTTCGATGCAAGGTACTGCTGGTCGGATGGTCCGATCGCGCATTATCATCAGTGAGATGAG
CCACCAGCCTCATGATGGTGGCAAAATAGATGCGACTGGCCTCAATGTGCTGCTCACGTGGCGAGTTCTTGGCGATATGAGCGAGGCAGAGCATAATCCC
CGTCACTTTGAATTGCAGCACACGCATATCGTTGCCTTCGGACGCCGTGATCAGCTCTCGATTCGCCCAGCTGAGGAATTGCGTCAAATAATGCTGTTCC
ATATCTGGTCTGCTCAGCAGTCGTGATAAACACACTGCCGCCGCAACTTGGGTAGCGCCTGGATCACTCAGATAGTCCTTGCAGAGCGTGACAATATTGG
ACACGATCGAGATCGTTCCGTTGGTGCCGTCACTGGCACTAGAAGACGACGAGTCGATGGTGTTGAGGTCAAAAGGCACGAGACACAGCATCGacagcca
cagcaacaacacgtAGCGCGTCTCCCACGCCGAGTGGTCGGTGCGGTCCtgagactgcagcagctgcagcgtcggctcGAAGTCGCTCACCTCGtgaggc
agcagcttcaccaccgtcttgTAGCCGCGCACCTTGCACAACTGGTACACGATCTGGAACAACTTGTGCAGCCTCGGGTCTCGGTACACTTGGCAGGGGA
AGGCCACTCCatcggcagctgcagctgttgcttcCACTCTCTCGGCCATCACGCGCTTGATCTCCGTCACGATGGGGTCCAGCATCTCGCGCAGATAAGG
ATCCAGTAGATGGGACTGCTCCAGGTACCTGTCCAGCTGAAGAATTCATTGCAAAAttagaagaagaagaagaggtaAAAAGTAATATAAGCAAAAAGAG
GCAATTTCGATGGAATGGCAGCGTACAATTTGAGTGACGGTGGAATGGTCAGCTAGGAACTCGCGGTCCACGTCGCACTGAGGCGTCGGCAACCGCGTGT
GCACCAGTTTCTGCAGCAGATTGCGCACTTGCTGGCGCTCttcgaagaagcgcttctCGCTGCAACTCTCACCCTCCATGGCGCTCTCGTC