Description :
From Genome Similarity Track
Location :
Scaffold_10:30142- 55557
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_10-snap-gene-0.14Titin
Pytiw_DAOMBR242034maker-piw_contig_10-snap-gene-0.15Conserved gene of unknown function

Sequence
25415 bases(100 bases per row)
TCACTCCTGGTGACGACTTCGTTGGCATTGTCCAGTTCGATATCGAGGTGACTGCGATTCACGGCAATGCAGTAGAGGTGGACGACATCGAGGAGTATTC
TAGTGAGTATATCACGATTTACCAAGTTGTGCTCGAGTGGTTCGACAGTGCGTCTTTCACGTCGATTCAGCCGAACCCACTGGGGACAGCAGTGTACCGG
AGTATGCCCATGCAACTCCAAACGAGCGCGACTTTGTCGTTCAGCTATCGGCTATCGTCAGGTAACGTGACATTGTCATGGGGGGTGCCCTTACGTTTTG
CCTGCTAACTCTGTCTATCGTGCTCTCGATCAGCATTCTCGACTTTGAAGACCGAGGTACTGCTCAATGAGACCGAGCGACGAGTACTCTGGTCAAGCAG
TGCTGATTCATTGTATCCGAAGCAATGGAGCAACGTGGAAGCTGTCATCTCGATCCTGTTTCCGTCGACTGTCGAACTCAGCTTTTTCGGTGAGGTGGAT
GCTAGTGACTTAATGTCCCTAAAGAGCATTGCGATTGCCAACTCTATTCAGCAAAGCCGCGTTGGAGAGCTCCAACTGGAGCATGCAACTGGCGGGATGA
TAGCGATCAGAGTACATAGCGTCATGGCAATTCCAGATCCAGTATTTTACAAAGTTCAGATGAAGCAAAGCGACGCGGTGCTTCCATCTGCAGCTGTCTA
TGCGGGTACAGAGCGCTATGTAGGTTGATTTGCTTGTACTCTTTCGCAGTTCACTGACGATGTCCTCATCACTTATGTTTCGTTTTCTCTAAAGGACCGG
GAGTCGAATACGACGGCTGCTATTCTCCAAATACACTGTACAAGCTCCCGCTCACTCTAGAAGATACAGCGGATCTGAGTCCGGTCACCCCGGCGCATTG
CGGATCACTCTGCTCGTACCAAGAGTCTCAAGCTCGCTTTTCAGCCATCTCAAAAGTGCAGAGCAAGCAGGTATTTCCAATGCCTCCGAGCGAATTCACA
CTTGAGTTTTGGCTCTACCAAGCAGTGAGCGCTAGCGTTGTCACAAGCAGGCCGCCCCAAGTCGTGATGGTGTACGGATCTGTGAACGCGAGCATGCACG
TGACACTCGACAGAGTCTTCACAATCTGGAGATGCAACCATTCACTGGTGCTACCGTTCGGGCTGCCCAGTCGCGAGTGGACCCACATGGCGTTATCGTT
CAGTGCCAGCAGTAAGATCGGCTTCTTTCTAAATGGACGAGTGGCAGCGGTGGGTGTGTTGAGCACCTCGGGTTGCGAACTTCCAAGCTCAGCAGTCTTT
CAGCTAGGACGAGGTATGGTTGCAAATTGCTGGTGAACGACTTGCTCGGTTACTGACACTCCCTTTGGAAACCTGCGTAGACTCGATGGAGATCTTGCCC
ACAAACTCAACTTCTTACTTCGACGGCAGCATGGACGAGGTACGATTTTTTGCAATGCAAGTCCTTCGGGTGTACTTCACATGATGGATACTAAGCCATT
TTTGCAACCTTTATGATCTTGGACAGATTCGTGTTTGGTATGGAGCTCGACAGGCAAGCGACATTTTCAGTTGGTTCAAGTCCAACATTGTCGAGCCCGC
AGAGATGGTGCTGCTGTTAAGATTCAACCAGAAGAATAGGACTAGTAGCCTACTATCTGGCGGCGATGAAAGTGGGAATGGCAACCATTTCGTTATACGA
GGGGTGGGCACGTCGCAGCAACTTCAAACGCGTTCGTTTGGACTCGCGGGCGATGGATCGTGTTACTGCAGCCAATTTGCTGTCCCAACCTCCTCTGCGC
TCGATCCCAATGTATGCGACCGTCAGTGCGGCGACGGCAGCGCTCAAAGCTGTGGGTCCATGACGACATCTCAAGCCGTGAGTGTGTACACTCGTGGTGC
GATTCAAATCGGCAGTCTCGCTTCCAACACCGAGTACGAATTTACCGCAACATTTGTGACAATCGACGGCGACGAGTTCGACATCAATCAACCGCTGGTG
GCTTCGACAACAAGCCCAACGATCCCAAGCCGCGTGAACTACCTCAGTGTCGTTGAACACCAGGGAAAGTATGTAGAGCTCCAGTGGATGGCTGTAGAAG
ATGATGGTGGCGCCCCGATCCTCAAGTACCAGGTGTTTGTGAACGGATACCTGGCATTTGAAACAGCGAACGGAGATACGCACTCGGCAGCTCTCGACAA
TTTCGACCTCCTGCCAAATTGCACCATTACAGTCTGTGCAGTAAACGAGCTCGGTGCTGGACCACAGCGGATGCTGGTGACGTTATTGCCGGCGGATTCT
AGTCTCCCCTCGACTCCGAAGCCGCTGGTTCCGATCATCGTCACAGGCGGCTCGGTGACATTCAGCACAGAAAATGTCACGTCAACTGTGACGTCGACCA
ACGCAACAGCTATACTGATCATCCAGCAGCGCGAATCGTCGCTTCGACAGTTTACAAACTCGATCACGCGAGTCAACGGATCTCAAGTGACTGTGTACAA
GCTCCGCTACGACACCACGTACGTCTTTCGTACGTATTCGATCAACGAAGTGGGCTCGTTGAGCCCGTTCAGCGCTCCAGTGATCGTTCAGACCAGTAAA
CTGAATGCACCTGGCAAGACTCCGACGCCAATCGTGACCCAAGTGACAGGTGGTTCGATATCAATGCTCATGACCGAGCCACTCAACACTGGCGGGCTCC
CGATCATCACGTTCAACATCTTCGTTCTTAACGGCACGGAGTTTGCGAAGCTTACGAGCGTGGCAGCAGGCGTCGATGGTGCGCAGACCACGACCATATA
TCGAGATACTAGCGGAGCGCACTTGAGCGCGTCCACGACGTACACGTTCAAAGCGCTCTCTTTGCAGTTCGGGAGCGCGTGTGAAGATCTTTCGACAGCC
GAACAGGAGAGCGACGAGTTTTCAGCAACGACATTGACTGCGTCGACCCCGTTGCCACCTTTGAAGCCGACTCTTCTTGTACTCGACGGTTGTGCTGCGT
CGATTGCACTCAGTCCTCTGGAAGACCAGAATGGTGCTGTCGTGAGTGGCGTCAATGTTCGGCTCTCCACTGGAGCTGGCGTGTCGCGCATGCTTGACAG
TGACTATGACTCAAGTTCGATTGCTCTGAATAGCTTGATGCCATTTTCGAATTACTCGGTGGCAGCGTCGGTGGCTACGAGTGAAGGAGATACTGCTTTT
AGTGAGTCGCTCTGGTTCACCACTGGTGCACCAAGTGCGCCGTCCAAGTTGCCCGTGTTCAAGATACTGAATGTGACGTCCAGTTCTCTTGTCCTACAAT
GGACACCGCCAGAGGCCACTGGAGGTGGAGCGATCAATGGTATGTTTGCTCTTCCGAACTCTTCTCCAGTGGAGAGTAAGACACTAACCATCTGAACTAA
CCTCTTATGCATGCTAGGTTACCGAGTCTACCAACGACCTATCCTGGCAGTGTCAGCAGCCAACACGCTGATCTATGACGGCATCAACAGCTCGACCAAG
ATGATTTTTGACGTGAAAAATCTACTCGCAAATACTGGTTACATCTTCGTGCTGCTGGCGTTCAACCAGTTCAACATTTCGAGTCTCGAGACTGACAACG
TGATCCATATCGCGAAACTCGAGCCTGCTAGTCCGACAGGTGTCGATATCCAGACGATTACCAGCGAATCCGGTGGCTCTCTCTCGATTGCACACTCGAT
GGTGTTTGACACGGGCGGCTTTGCGGTTGAACTGGTCCGATACTACGCCAGAGTGCGATTCCTGAACTCGTGCTATAACTCATCATCGGCAGCGTGCGAG
AAGTGCTCAGCGACTCTGTTTGACGATGCTGGTGGCATTTTCCACATTGGCGCGCCAAAAGAGACCTGCTCCCCCACCGCTTGCGATACTGACGGGACTT
GCTGTCGCGATACAAATGGGCAGTCGTGCGGCATTCTTGGCGAGATGATTGAGTTATGTTCTTCGGAATCAACGGCAATATGCAAAGTCGATGGTTTGAC
GTACTTTACGATCTACGCGACGTCCATGAGCGCTGGGAATCCGATCGGAAACAGCAGCTTCTCAGCAGAACTGTTCACCTCGACAAGGTACCGTACAAGG
ATTTGCTCTTGTAAATGTTGTTCACTGACAGACACGCTAACCACTTCAATTCCATCTTCAGTTCAGCCACAGAGCCCGACGCACCAACACTCGAGCTGGT
CTCGTCCCACGGTGGCGCGATTCAACTCCAGTGGGCAATGCCAAAGGTAACCACGCTGACATGTTCTATGACTGTATTGCCTCAACTTCCACCAGCATTG
CTAACCGCCTAGGCCGTCCATAGGAAACCGGTGGTGCTCCGATTATCCGGCGCTCGCTGTTTGTAGAAGGAGAGCCGCTGGACGAATCGACGAATCATGT
TAACTTCTCGCACTGCCAACTTCGCGCCGAGAGAGATTACACGTACAGACTCGAAATCGAGAACTCGAAAGGCTTCGTGAAGAGCATCACTCAGTCTTTT
TGGACCACGACCAACAGTGCACCGTCAGATCCGCCGCAGCTGACGCTCAGCACAGTCTTTGTGGGATTGGCGACGATTAGTGTCAGTGAACCTTGTAACA
AGGGAGGGTACTCACGACTGGACTACGCCTACGAACTTCGAAACGCGGCGAGTAATGCGATCGTCACTCAAGCCGCGTTCCAGTGCTGCGAGTTGACTCT
AAGTGACTTGCAGCCTTCGAAGGCGTACATTGTCCGCGTGCGCGCAGGCAATGCCGTGGGTCAAGGCAACTGGGCCGAGCTGAGCTTCACCACTCCCAGT
GGGGTCGCTTCGAAACCGACCACTTCGCTTCTGTACGCATCATCAACAAAGTTGGAGCTGTCAATCTCCCCACCCGTAGCAGTTAACATCAGTGTACTGA
CGATCGAAGTGGCGGCGAAGAATGCCGCAACAGGAGATGAGGTGTACCGACAAAGCTTCGACTGCAACATCATCGGAGCGGAGACGACGTGCCCCGAATC
AGTCGTGATCGACGGACTCGACGATACCCAACCTTCGTACACCGTGATGGTGCGCTCACTCGCTGACGGAGGGGACAGCGATTGGTTTGAGGAGACGTAT
ACGACGGATTCTGGGGAGCCAGGCACACTTGGGTTTCGGAAAACCGAGTACTCGATCAAAGAGGAGGAGTATCTCGCAGTGGATATCGCGCGCCTGTATG
GCACAACGGTCACTGAGGACGTCACATTCGAGATCACAGATACCATTGCGTTCACTGTCAGCTGGACTTGCGAGCAGACTTCGTTCGGCGCATCGTGTCA
TTCATCCGAGGCTGGAGACAATTCAGGTACGTTGTAATCTTTGGGAATTGATTTCTGTGGTGGCCTAGTAAATCTAAACTTGTTTCTCATTTTAACTGAT
TGACGTGCTCTGGTTACCGTGATTTTCACCATAGGGCTCGTGTCATTTGACGTTGGTGAGTACGCGAAGACTGTGGAGCTGCTGATCCCAAACGACGACG
ACTACCAGGCCTCTGCTGGCAACATCTCGATGATGTTGGTGTCCGCCACCTCCAGTGCGCTTGGAACGCGCACTCATGCTGAGATCATTGTCGTCGACAA
CTACGACGCGGGCAGGATTGGCTTTCAGGATTTGTCAGCAAAAACTGTAGGTGAGACTGCAAGGATCAACCTTGTGCGCGATCGCGGCAGCGCCGGAACC
GTCACGGCCCGTGTAGTCTCGACAATGTCGGGATTTATCGAGGGGGCCAAGATCAACGCTATCGTGACTTTCGCGCCTGGCGAGACGCTCACATCCATCG
ACATACCAATTCGAGCCACCGACGAGTATGTTTTTGGAACCTTTGAGCTGAGTCTTGTAGATGCATCCAACGGTGCGATCCTGGGCTCTAATTTCATGAC
CGTCGACATGTTGAATGTCGACGGCGTGAGTCTTCCTGGCAGCGCAAAGCTGGCGGTGAGTGCAGCCACAGGGGGTTCGATCGACTTCCAATGGGCCGAC
CCGCACTTTCCCGGAGGCCCCGCCGCCATTATCGTGCAGTACGAGCTCGAGCTCAAAGCTGACAACGGATCGATTTCGAGATACATCGAGTCGAGGGTGA
ACTCGCTCCATGTCTCGCGTCTGAGGAGCATCAGCGCCTACCAGGCGAGGATCGCTGTAGTCAACCAGCGCGGGCGAGGCAGCTTCTCCGACTACGTGAG
TGTCCAAACAGCCACACCAGACAATCCAGGAGCTGTCAGAGAGCTGAAGGTCATTGAGCTGACAGGAAGTCTCGCTCGAATCGGATGGCTGGAGCCCCTC
GAACTTGGTGGAGTCACCTTAGCGCTCTATCGAATTACCTTTGAAGAGCCTCCAGATGGCATACTTCGCACCGTTGAAGTGGATACATCATCGTGGACGG
CTTCAATTGGAGATCTGAAACCTCGAACAGTCTACGAGTTTACAGTCGTGGCTGTGAACCTTATTGGCATGGTTGGTTTGGAAATTTCGATCCCTCTCGA
GACTTTGGACGAAACAGTACCGGATTTGCCACCGAAACCAATCCTGACGATGGCCACGGGTGGAGCTCTGCAGTTCAATGTGCTTGCTCCGCTCGATACT
GGCGGCTCGGAGCTCATCGATTACACTGTGTACGTCGCGCGCCTCACGGGGTGGGATGTTAAGTACCACGAGTTCGCGACGTACTCGATCACGAGCAAAT
CCGCGGCTGGGGTCATCGGGAACGAGTCAATGTACGATCTACTTCCAGAGTCGACGTACTACGTGAAAGTCTCAGTCCAAAACGCAATGGTAAGTACTTG
GACCTCTAGCAAGCTATAAATCTGAACGCTCCTCTTCCCACATGACTAACGATTGTATTTCGTGCCTTACAGGGATCGAGCCAGCAAAGCGAGAATGCTG
CTTTTGCCACCACTAAGATGACACTGGTTGTGGGTATTGGCAAGCCAGTCGTCGTTGTCGAAGACCCGGGCGAGATGACATTAAAGTGGGCCAGGCCGAT
CGACTCGGGTGGGGCGCGTATCACTGGATACGTGTTGCACGCGCGGCACTGGCGCCCGACCAATGCAACGTGGTCGGATCTAGCGATCGTGTACGACGGC
CGCAACTCCATCGTGCAAACAGCGAAGATCCAAGGTCTCGCGGCGAGCACGCGCTACGCATTCAGCGTCGTCGCGTACACCTACCAATCGTTGTGCGTCG
CCGAGAACCTCCTTTCCAGTAGCGAGGAGCTGGTGATAACGACTCAGGACGGAAACACCCCGTACGAGCCAAAGAACCTGCACGTAGCTGGTGTAACGGG
CGGCGCAGTGACGGTCGCGTGGGATCCGCCGCTCTCCTTTGGCGGCGACGCTGTGCTGGCATACGTTGTGTACGGCGGTAACGCTGGCGAAGATTTCTTC
GTGCTCGCGAGCGTCGACGTGTTGGCGCCGCGATCACTCACGATGTTTGGTTTGCAGATGTCAAGCAAGTACAATTTTGCAGTGTGCGCGGAAAACGTCC
GTGGGCTCGGGCGTAATGCGACGCTCATGAACGTGACAACGCTGGAGCCAACGCCACCAAGTGAGCCAAAGAACCTGCAGCAGATCCCGTCCATGTCCGG
AGGCGCGATCACTTTATCCTGGGACCCGCCCGACGATGCGGGTGGCATCACGCTTCAGAGCTACGATGTCTACCGGAATGCCTCGTTCGTCATCAGTGTC
GAAGCTATGGACGGGAGTACTGAGCTTACCGACATGGACAGCATTGCAGCGAGTCACATCTATAACTACTCGGTGTTTGCCGTCAACTCGCTGGTGCGTG
GCGACAGGCCAGCATCAATCTACGCTCGCAGTCCGGCTGCCACAATTCCACAGCCTCCGAGTGTCAGCATCGTCGAGACGAGAGGCGGAGCAGTAAATCT
GCATTGGGCGCCGTCTCCAGATTCTGGAGGCATTCCGATCCTGAATTATAAAGTCATCCTCACGAGGGGCGGCACCAGTGTGACGTCGTATGAAGGCTTG
CTCACTGACTACGTGTTTCAAGGCTTGTTTGCAGACACGGAGTACCGGTTCAGCGTTCAGACGAGGAACACGCTGGGGCTGAGCTCGATCACGAAAGCGC
TCGCGATCACTGACGATGCTGAGCAACCTGGGCAACCGATAGCTCCAAAGGTCATTGGCACATTTGGAGGCCGCGTTCGATTTGAAGCGACAACACCGAA
GGACTTTGGCGGGAGCCCAATCACCTCATATCAGTTTTTCATTAACGACGAGTCCGTGGACGCTATCGAGGTGTCGGCGAACGTGTACGACATTGTCGAG
CTCACAGCTACGACTATGTACTCATTCGAAGTGGCCGCTGAGAACGTTGTCGGACAAGGAGTGACCAGTGACCCCATTCAGGTTGCAACAACGTCAGTCA
CTCAGCCTGGGGTGATCACGGTGATGGATGTGGAATTCGTCACGTTCGACAGTGTCGAGATTGCATGGAACCAACCACGTGATACTGGCGGTGCTATGGC
TTCCAGTCTCGTGTACAGTATCCTGGTCAAGAACAGCAGCAATAACGCTTTGTGGGCGATCCCGAACGCAAGGTCCCCCTACGATATCGTTGCGCTCGAG
CCAAGCACGTACTTTGCGATCCAAGTGCGTGCAGAGAACTCAGCCGGCTTCGGAGAATGGAGTAGCGCTGCAGTCACGAAAACTGATCCAATCTCCCCCG
GGACAATGAGCTTCACGACGAACTGGATGAGCGTGTCAGAGGGCAATTCGACGGTCCAAATCACGGTCATTCGGTTGAGCGGTGGCTCGATCCCCGCTGC
ATGCAAATATCAGACGATGAATGGTACCGCCCTCAGCGGCGTCCACTACATGGGGACGCCAGCTGGTACGATTAACTTTGCCACAGGCGTAAAGCAGCAA
GTTGTGACCGTTGCTATCATCAACAACGATGTCCAAGACGACCCAGACAAGTACTTTTACGTGAAGCTCATGGAGATCGACTTTGCATCGGGTGCAATCG
GCGATATCGGTGTGATCAGCGTGACAATTAGCGACGACGGCGACGCCGGGCTCATCCAGTTCTCCCAGACTTCGTACTCGATCGTCGAGTCGACACCTAG
CGTGCTCGTTATCCCGCTCGTACGAATCAACTCATTCAGCGGCAGTACGATCGCTCGCATTGACGCGTTTGACGTCCTCGACGGCGCGATCCAGAGTGTC
GACTATGTGCTTCTCGATTCGACTGCCGTGTTTGCAGACCGCCAACTTGGAGCGACTATACGCGTGAAGATCGTGAACGACGCTGTGTTCCAGGTGCGCA
AGTTCTTTGGACTGAATCTCACGATCGCCTCGGGTCGCGCAGAAGTCGGTGCGCTTGTGACTGCGTTTGTCGAGATCCTTGACGATGGCGATGCATCGCG
ACCGTGGCCACCGACGGATGTCAAGGTCACGACTATCTCTGGGGGATTGGTGAACCTGAACTGGACCGCCCCCGTGAACAAAGGAGTCGCGAACGCGACG
TTCCTGTCATATCGAGTCGTCGTGACGTCGGATATGCAACTGACGCAGGAGTTCACGACGTTCAACACGTCGCTCAATATCACCTACTTAGTTGCAAAGT
CGAACATTGGCGTTGCGATCGCGGGGAAAAACGACTACTTTGAGAGCTATCTGTCGGCTCCCGTGCTTGGTCACGTGGGGGTGCCCACGCCGCCCACTGC
ACCACAAGCAACCCAGATTCAGTGGCGCACTGGCGGCGCAGCCAACATCACCTGGCTCCCGCCGTACGACTTTGGTGGTGCGGATATCTTGCTCTACCGA
GTCAACGTCACCACGGGGCCCGCTGCCACACCCACACTCACTCAGTATACGACACAGACCACGAGCCTAGGTGTGTACGGACTGCAGTCGCTCACAAACT
ATGGCGTCACCGTCCAGGCGCAGAACTATGAAGGACTGAACGGAGTGATCTCGCCATCGGTGACGTTAACGACTCGCGCGTCTTCTGCACCAAGCAAGCC
ACCGGGCGTCAATGTGTCCAAGGCGACCGGCGGCGCGCTGTATCTGGACCTGGTGCCGTCGTTGGACATGGGTGGCCTTCCTATCGCCAAAATCACACTA
TGTGCAACGTCGCCGGCATTTCCAAACGTGTACACTGACATTTACGAAGGCACGGATTCCAAGTACGTTCTGATTCGACTGCCGTACTTGACAGAGTACA
GATTTAGGTACAAGGTCACAAACGCAGTGGTACGTCACCTCTTTGTCTCACGATTGTATCTTTATGACTGTTAACTCTTGCTGACTGTTAACTCTTGCTG
ACTGTACTCTATGCATCCCAACCAGGGCGTGAGCGAGTCAAGCGATGTGCTAGTGACCAAAACAAAGTTTATCACGCTGCCAGACGTGCCTCGGAGCACC
ACGATCTTAGGCACAACAGGAGGCTCAGCTACGCTTTCCTGGACACTGCCGCTTGACTTTGGTGGGACGGACATCACGACCTACGAGGTCTCGTTCTTTA
CAGGCTACCAAGTTACAGCGCAGTACAAGCAGCTGATCTCAAATGTGAGTGCGAATGCGACGACCGTGACAGCGAAAGTCTCGGGACTCAATGCTACAAC
GACCTACGGCTTCTTCGTCCTCGCGGTGAACGATCTCAGCGCCTGTGGGGATAACACGACACTATCGGGTGATAGCGTTGTCTATGCCACGACTGGGAGA
GTTTCGGCACCGGCGGTCCCGCTGAACTTGAACGTGACGCTCACCACCACCGGGATGCAAGTGATCAGCTGGTCGCCAACGAATGACCGCGGTGGTGATC
CGGTGGTTCAGTACGTACTTCTTTCCGACACCAATGCCGTACTTTACAGTGGCACCCAAACAAGCTTCCAACGTGGGTCTCTCTCACCAAGCACGATCTA
TGGGTACGCCATCAGAGCCAAGAATGAAGCAGGCACGAGTATCCTCAGCCCAGTGGTGTATAGGACAACACAGAGTCGTATCACAGTTCCTGGCGCACCA
CTCAACCTCGTGTTCATCAACGCGACGGGTGGCTTGATCTCGCTATCATGGACCCCGCCGATGGACACTGGAGGCGAGGCACTCCTGGGCTTCCGAGTCT
TTCGCGACAGCAAGCCATTGGCAATACCGGATGGGCAACTGTACTACCAGAGCACGACCTATGTGGACAGCTCCGGGCTTGTCGCCGAGAAGAAGTACTT
GTACACAATCCAGGCAGGGAACTCGCTTGGCGTCGGCTCGTTCAGCGACGGGCTTCTTGCGCAGACTACCATGGCAACGCTGCCACGCAGACCCAAGAAT
CTGGTAACGGTGGCTCTGGGTGGGAAACTGTCGCTGACGTGGACGCCTCCAAGCGACACTGGTGGAATCCCGCTCGAGGACTACTACGTAAAGATCTCCA
GAGGCGACACTCTACTGACGGACCTGCTGCTCAACGAAACGTCTTACGACTATTACGGCATTTACGCGAAGACGAACTACACGGTGCTCGTTGCTGCGAC
CAGCAAGATTGGCGACGGCCCGGAGGCCGTGCGATCCATCGTGAACGGCAACGCGATCCGGCCTCAGGCACCGTATCCACTCGAGTTTATCAGTTCCAGT
TCACAGAGCATGGTGCTGGCGCTTAAGGGACCGCGCGATAATGGTGGCGCAGACATCACCATGTTAAAACTGTACCAGAATGGCGTGCTCGTGCGGTCGG
TGCAGACGAGCGGGTATTTCCAGGTGTTTGTCACTCCGCTCCTTGCGAGCAAAGTGTACTCGTTTACGACTACTGCAGTCTCGGATCCTGCGCTGGGCGA
GAGTCCGCAAAGCGACTCCGTCACGGCGACCACTACGAACTCCACAACCCCATCCGCTGTGTACAACCTCGCGGTGACTCAACGTACGTTCAACTCGCTC
ACCCTCGTGTGGGAGGGGCCGGACGACATTGGCGGCGAGAGTGTGGTCTACGAGATCGAGTACAGTGTGAAGCTGAGCATCGTGGCCATCACAAAAGCCA
CGACAATACAGACAATCACGATCGATAAACTGACGCCCATCACGTCGTATATGGTGCGCATGAGAGCAAAGAACACCGCCGGAGCCAGCGCCTGGACAGC
TACAGTCCAGGGAGATACGGACGTGGCGCAGCGAGGCGCAGTCGTATTCCGTCCTGAGCGAACAACAGTGTTTGAGAACGGCACCTCCGTGACTATTAAG
TTGACTCGCGTGAACGGGACGTCGAGTGGCATTATCTGCTATTACGATGTCGCAGCGAGCAGCACCGCGAGAGCTGGGAACGACTTTGTGCTCCCACCTC
TCGTTGATCGCACATTCGCCTTCATCGATGGCGAGACACTCAAGAGTCTCACGATCACGCTTGTCAACGACGTCGTGTACGAGTCGCCGCCGCGCGAACT
CGCTCTTGTCTTGTACGACACGACGCCAGGCCGATCTGACACGGTAGCACCTGCGAACGCGTCAATCTTCATCCTTGACGACGGGGACGCAGGCTGGATC
GATTTTCCCGTGTCGGAACTGACTGTCCTTGAAGATGCGACGAAGCTTAGCGTTCCACTACAACGGGTGAATGGTAGCAGCTCAGTCACAGCCGTGCGCG
TGCTAGTTTACAGCGAGATACCCTGTACAGCAGTTACGCCGAGTGACTTTACGATCGCGACACCCGTCGTGACGTTTGCTGATAGCCAAGCTAGTCAAGC
TGCCACCATCCGCATCTGGAACAACGCTGTGTACGACTACCCACTCAAGTATTTCTACCTCACAGTGACTGCTGAGAGTGGCGGAGGGCAAATCGGACCA
AGAACGGTCGTCAAGGTCACGATTCTTGACGACGGAGATCACTCGGTGCCTGGGCTAACTCGAGATCAAACGCTGGTGAGTGCAACAGGTGGGATGATCA
CGCTTACCTGGGTGCCTCCGGTGAACCTCGGTGGCCAAACACTGATGATCACGAACTACAACCTCTCGATCGTCGCTAGAGTCGTCAATGCAACCGCCAA
GTACTTCGTTACAAATGACAACAGAACCGAGTTTTTATTCGGCGGCTTGGAGTCTGTTAGAACGTACGCGTTCCAGATTGCAGCAATGAACGCAGAGGGG
ACGGGTAACTTCAGCGCCGTCACTGAAGAGAAGACCACGAACTTCACGACCCCAGGCGTCATGGATGCGATCTTTCTTCTGGAAGCAACAGGCGGCCTGC
TAACCATCGAGGTTGCACCTCCCCTGGACACAGGCGGCGCTCTACTCAGAAAATACTTAGTGTACATTGCGACCGCAGATGACCCCGATTTCAAGGTACG
GGTTTAATCCGACGTATGTGATTCGTGTGGTGACTGACTGATTGGAGGCGCTACTGTATGGTTTGATGTTTTTTCTCTTGATGCTAGCTTGCTGCTGGCG
GAAACACGACGGACAACTCGACCACGATCCAGCTCAGCGTTCGCTTTCCCGACACCATCTACTTCATCGTGGCACAGGTTCGTTCAGCTGATGCATAGAC
TGTCAGCTTGGCATTCATCAACCTCATTACCCAATCTGCGACTGACCTGTATGACTGCTGTTGCTGGTGTGATTTTTGGGTGTAGGCGGCCAACTTCGTC
GGCCCCGGTGACCTTTCGGGTGTGTTCAGCGTCTCTAGTGGCGCGCTATCGCGTCCTAGTCCGCCACGGATCCGAGATAAGGCCAACTCGACGACTGGCG
GTTCCATCGTTCTCTTCTGGGACATCCCTCTCGATACAGGTTTGCTTGCCGTCACCCTCTCGCTATCTTTGCTATAGGATCGCTAGCGTGCCTCTGACAC
AAGTTGTTGAAATGAAACAGGTGGCCATCAGGATCTCGAGTACACTTTCTACCACCGAGCGCGGGATCAAGACGAGCGCTACCAGCTGGCGTCCTACTAC
CAAACAGATACCCTCGTGGTCGTGTACAACCTCGCAGCGGAAACGAACTATGACTTTGCCGGCATTTCTCTCCTCAGTAGCGACCTCGACGTCCTTTCGA
ACGGCACAATCGCTGACGGCTGGATGAATATATCCGTCCCGGTGGACCTCACGACGCTTTTGATGCCCAACGACCTCTTCGACTTTGGAGTACGTGCTGC
ATCTGATAATTTCTCTCATGCTCGTTTGATGACTGGTACTCACGAGCTGTCTGGTGTGCTGTGTATTCTGTCTATCTCTAGGACTTTCTGTTCCAAGTGG
ACCCGCTCGAGGGCGTCACATCAGAGCTTGTCGTTTTCAAGCCTGAGGTGAATTTAGCAACCGGATCTACGAGAGAGACGACCCTAAGTCTGGACGACAC
CTACGATCTTCAGTTCCGTGGACCGATCAGCAGTGCTGTCAACTTCACGACCGGTCCTCCATCTCTCCCAGGCGTGCCTCCGATGCCAGAGTTCGTGCAC
TCCACTGGCGGTATGCTCGTCCTTCGGATCTTTACGCCAAATGACACGGGTACAACACAGTTGGCATGATTATTGCAAATTTGGAAGGCTGAGCTAACAT
TTTGTGGATGGTTTTGCATACCAGGGGGAGTCTACATCCTCGATTTTGATCTCTATCTCAACGAGCGCAAGGTACACGGCCCTGCCCGCTGTATCTAGTT
GTACACACTCAGTGTCACCTGACCAGAGGTCGAACTAACCATACCTGACCACTATCACAATCTGTATTTCCACCAAATCGTGCAGGTTATGGCAAACTAT
GTCGGCTTCAATTTGCATCGAAAGTTTCTCCTCGACGTGAGCATTGAGCTGGGCAACTTGGCGCCAAACCAAGAGTACCGCTTCGTATACGTGCCGCTGA
ACACGGTCTCCCAGTGTTTCCCAATCAAGCCGCCCCTGGACCAGCCGATGATCTTCAGCACTGGCGACGCCACGCTGCCGAGCATGATTGAACGCCTGTA
CCAGTCCGGTGCCACAGGTGGTGGCATTCGCGTCGAATGGAATATCCCCGTGGATGTCGGCAGCGACAGCGACATTTTCTACCAAGTGTACATGAGCGTG
AAGCTCAAGACCCCCGAGTATGCGCTCGTGTACAACGGCACGGAGACGTACTATTGGAAGACCAACCTCGACAGCGAGCGCGCGTACATGTTCATGGTTA
CGTGCTTGAACTCGATCGGGTACTCACCGGACTCGCTCGAGGTGATGCTCAACACGACATTCATTTCGGTGCCCGGTCCCACGGGGCCGCTCACGAAGAG
TGTGACAACCGGCGGAATGATCTTCTTCTCGTGGACACCTCCGCTAGACGACGGCGGCAACGAAGTGACGAGCTATCTCGTCAACGGTAATGACCATGAC
GTGGAAGTAGCGAAAACTGAGATCGCCTTTGGCGGACTCTCGGCGAACACGGAGTACACGTTCACAGTGTATGCCGGCAATGCGCTTGGCTTTGGAACGG
ACGGAGCGTTTGCGTCGTTCAAGACGGGAGATGTGTCACCTCCATCCGAGCCGCCGTCGATCCAAGTCGTCAAGGTGTCGGGTGGATCGGCCACGCTTGC
GATCGCTGTACCAGTAGATACGGGTGGCGTAAGTACGGCGAAACTCTTGTACGAGGTCTATGCGAACAACGTCCTTGTCGCGCCGCTAATGGTCCATCCT
CTGAGTGCTGCACCACCCGACCTGCTGCCTTTACCGAGCCGTCGCCTGGAATCCCAAAGTCAATGCCAACCAATCGAGTTTGGCGCCATAATTGGCTTTG
AGACTTCTTCACATCGACGCCTCGCAGCGAGTGATCCACCACTGCTGTACGTGCAAGTCGGGAGTTTGCTACCCTCTACACCCTACAGTTTCACCTTGAA
ATTCAGGAACGCAGCTGGAAGAAGTGCCATTACCGGCAGCACTACGGGCGACACGGTGCAGGTGACTCCTCCGGACCGGCCAGCAGCTCCCAAGGCAGGT
GTCATCACTGGTGGTGCAATGACGCTGAGCTGGTTGGACCCTGTGGACACTGGCGGCGTGCCGCTAACGTCGTACGCGTTGATCGTTACGGCGGTCCAAG
GTGAAGTCGGTCGCTGCGAAGGCCTCATCCACTCGTGCGAGGTCGGGGACCTCCAGTCGCTCACCGAGTACTCGGTTGTGCTGACCGCGTACAACATCGT
GGGCGCATCGCCACCGAGTAAGTCCGTGGTGTACACCACGGTCTTGCCCACAAAAGCTCAGGAGCCGCAGAACCCGCGCGTCGTGAGCGTCACTGACACG
ATTGTGCTGTTAGACTGGCTGCCAACTGATGACTTTGGTGGAAACTACGTTGAGAGCTACTACGTTGAAGTGCGGCCTTCGTCGCAGCTAACACCAAACG
TGATCACATCGGTGGCAGTGCCGATCTCAACGCTCAGTGCGACCGTGCCAGACCTCGTGCCAAACGTGAACTACTACGCAACTATTGTAAGTCGCAGTGT
TAAACATTTGATGTCTCTGTCCACGATGCAAGTGACTAACTTTCGCTTTGTATTTTGTAGGCTACGAAGAATGGCGACGGCGACCTGGGCGTGGCGAGCA
AGCGTGTGTACTTTACAACGGCGCGGATCGTTGGCCAGCCGCAGCCGCCGCTCATCGGATGTGGTACGTAGAGATTGATCTTCATTACCTTAATGTTGGT
TGCAACTGATTGGTGACTCAAATGTCTTGTTGATTTCCATTAGTCTCGCAGTTGGTCGTGTCTGTCTACTGGGCCGAAATGGAGGGCGTGACGAAGTACT
TACTCTATCGAGACACCACACTACTCGTGTACTCGGGGCCAAACACGTTCGCAGAAGACAACGCTGTTAAGCCAGGCAACACGTACTCATACCAGCTGCG
CGTCGAGAACTCAAGCGGCAACCTGTCGATCGCGAGTGAGCCGACAATGTACTTTGCTGCAGAGGCTCCGGCATTTGCTGCCGCAGACGAGTTCCAATGT
GGCGGTGTGAAAGGCTATATCCGTCTCAAGGACTACACAAACAGTCAGACGCGACAGTGGCGCATCGCGCCTGCTGCCCCCGCGAGTGTCCTCCTCAACG
TACGTTGCTTCGATGCGATTCCCGAATGGCTAACATTGTGAATCACTGATCTGATTTGATGAGAAATCTCTGGTTTGTAGGTGACGCTGTTCTCGCTTGA
GTGTAACTTTGACAACGTCCAGATCACCGCGACAATGAACGGTGTGGCCACGTCACTGTGGAGCGGTGGGTGTCGACGCAGTGGGAAGTTCTTTATCTCG
ACCGACGGTGACGTCGACTCGCTCGTCGTATCGTTCACGTCGGACGTGAGCATCTCGTACTCGGGACTTGCGATCACCTACGAACTTGAAGCTGGCGCCG
CCGTTGTTGCGAGCAAGACCGTGCCATGCCCCGGCCCGGCAATCTGCTCTAACAACGGCGCGTGTATCGATGGCCGCTGCACTTGTTTGAGTGGCTTCAC
GGGCGAGGACTGCAGCAACTCGGTCGTGTGTCCTCTCGACCTGGCGAGCTGTGGCACGCACTGCGACCCGATCTGCTCGGAGAAAATAGAAAACGTCATC
GTTGTGAGCATGTACGGCGATGATATACAGGGAACCGGCGAGATGATGGACTCTTCCCAGGCTGGAACAGCACCAAAGGCTGTCAAAACACTCCAACGAG
CGCTCGCGATAGCGACGGGGGGACAAACCATTCTTATCTACCCTGGCATGTATCAGGGTGCACTCAACTGCGACTTGCTCGTAACCAAGCAGGTAACTAT
TCGAGGACTCCGAGGTATAGCAGTGACGACGATCGACTGTTTGAGTTCTTTCCGTGGGATCACAATCGCTGGAGCTGTGGGTGCCAAGCTGGTGGATTTC
ACACTAATCAACACGACTGGAACCGATGGGGCCGCTGTAAAAGTGGTCTCGAGTACCAGCACAAAAATCATTGGCTTGCGTATCACCGGCGCCACTGCTA
CGATGAATGGCGGCGTGGTCTTCGCATCCCAGTCCGAGCTCACATTGCAAGACACGGTCGTGAAGAGCGGCTTGGCTGTGCTTGGAGGTGGGGGTATATA
CATCGACAGCGTGGCTCTGACGCTTCAGAATGTGAATGTGAGTGGATGCCAGGCACTGGATGGCGGTGGTCTCTACGTAACTGGTATTTCGTCGATTACA
GGCATCGGATCAACAATGATCGAGAAAAATGCAGCCGGCAACCGTGGTGGTGGCCTCTTCCTCTCCACGGGAACTTGTTCAGCAAGGCAGCTCGTGGTGC
GAAACAACAACGCCGTGTTTGGCGGCGGCGCGGCGTTCGAGTCGGGGATTTTCTCCTTCACGTCCGTGAACGTGACCACAAACAATGCAACGCTTGATGG
CGGAGGCATTGCTGTTCTCCTTGACGCCCAGTTCACGTCAATAGGCTCGAATTTTCGCCGAAACGCGGCTCAGCGCAACGGAGGCGGCGTGGTTCTCACG
ACCAACAAAAGTCTCAGCTTTGACTCGCGGTCGCTCGTGTCGAAGAGCACGGCAGGTGCGTTCATTGAGCCAGAAATGTCTGTAATTGCCCACAGTGTGT
GGTGTCTAACAGTGTTTTTATCTATTGTGTCTCGATCTAGTTCTCGGCGGCGGACTGTATGGCGAATACACCAGCGCAAGCATCAGTGGGTTGGTTGTCA
AGACCTGTGTTGCTACAACTGCGGGTGGATGTGTCGCGTTCATCGCAAGCTCCAGCCGCCTCACAGGGATCGACTTCAGTAATTGCTCGGCTCCTATAGG
TGGCGGCATGCACGTCACGCTGAAAAGCGTCGTTGAGCTAGTGGACGCGTCCATCTCGTCCAGCATCAGCATGAACGGCGCCGGTGCCTACGTGGACACG
AGTTCCCTCGTGGGGACGAGAGCGACTGTGACGAGCAGCGTTGCAGGTGGCTGGGGAGGTGGCGTATTCGTCACCGGTGTCAGCAGCAGCCTCAGTGGGA
TCTCGATTCGCAACTGCTTAGCTCCGCAGGGAGGCGGCATCGTCGTCTGGAACGTAAGAGAAGGAGCGCTTACCGACGTCGAAGTCATTGGAAACCACGT
CACGAACGAGGGTGGAGGCATTCACGCGAGCGAGAGCGATCTCGTGGTTAGCAACACATGGGTGGCGAACAACATGGCCATCTACGGCGGCGGGCTCTAC
GCCTCGAACGCATCAGTCGTGGGAACGCTGACCCTCGCGTTCAATAACGCAACGTATGGAGGCGGTGCCCTGTCGACCGGGATCACACGTCTAACGAGAA
CTGTGTTCAACTCGAATACCGCGCAAGAATATGGCGGTGGGCTCTACGCGAGCGATGGTGAGCTCATGCTCCAGGAAGTTGACGTTAAGTCCTGTGTATC
GACTGTCGGCGGCGGGCTATGCATCATGACAGCAAAGCTATTCCACGACCAAGTGCGCATCTCGGGCTGCGTGGCTGAGACGGGCGGTGGGCTGTACGTG
AACTCGGCGTCCTTCACGCCCGTCGCGACGAACTCGTCAGCTGTTGCCGTGCTGAAGCTGAACAGCGCTTCGAGCTTTGGTGGCGCGATCTACGTCACGG
GCAACGACACAAAACTGGAGGGCCTTAGCATCTCGGCCAGCTCAGCTATCAGAGGTGGTGGGATTGCAGTCGAACATGCGTGGAACTGTACGATCACGAA
TGGGTGGATCGCGAATTCCACGGCTAGGGCAATCGCGAATTCCACGATTAGGGCAATTGGTGGCGGCGCGTATTTTGGCACAGACACCCGAAGCCTCGTC
ACGAACCTTGTTGTCGAGCTCAACAGTGCGCATTACGCCGGCGGAGGCATGGCGGTCTACCAGGCCCTGCTGACACACTCAAATCTGGTCATCCGCGGCA
ACAAGGCCGAGAAAGGCGGCGGGCTGTACTTGAGCAACGCTGCGGACGTGGTGCCATGGACTGACGCGGCCTTTGAGCGGTCGCTCCTCGATGCGAACGC
GCGTGGTTACTCCCTTACAAGTGGCGCGAATGTACAGGTCGAGTGTGCCATAAACTGCACGCTCTCAAGCTTCCGCATCACGCGTGGCGTCGTGTCTAAC
GGTACAGGTGGTGGGGTGTACGTCACGGGACAGGGGAACATCCTGCTCATGGATCTGGCAGTCGAGAGCAACTACGCGGTTAGTGGTGGCGGTTTGTCCA
TCGAAAAAGCTAGCAACACGGTCGTTCGGTCCTGTAGCTTTACTGGCAACGCTGCAAGAAATGACGGCGGGGGCGTGCGCGTCATGGGCGCAAACTCAGC
GACTACCATAGTCACAGTAAGCGACAGCGTGTTTTACAACAATACGGCGAAAGGCAAAGGCGGTGGCGCGATCTACATACAAGAGTCGTACGTCCTTGGC
TCGTCGCTTCTAGTACTGGAGAATCGAGGCCTGGCGACTTCGATTGTTCAGAACAATACGCGACGAACGGGCGGAGGCGCGTGCATCTTTGGTAAATCGT
GTCTGTCGGTCGACAACAGTCTCTTTCTACTCAACCAGGCGCCTTATGGTGGGGCCATCGCGGCAGAATCCGAGTCTAAGATTGTGATCAACGGCTCGTC
GCTCACGAACGACGCAACGCTCTTCACAGCTGACTGGGCCGCCATGTTCACGCGTCTTGTCGGCGTAGAGTACCTTGTGGGGCAAGCCAATGAGGTTGAT
CCCTTCACAGGCGCACTGAGTGGTGGCCACCTATACCTTGAAGGTGAAAACACGCAGATGGATATCACGAACTCGCTCGTGACGAACGGGAGCGCTGAAT
TTGGCGGCGGCGTCTCGGTCGAGGGCACCGCGGTGTTGAACGTGGGAGAGTCGATCTTCTCGAATAACCACGCCAGTGAAGGTGGCGGGAGTGTGTACGT
GCAAAAGGTCATTGCGCGTGTGAGCTTCAGCTTGTCAGTGATCAGCAACAGCAGTGAGTAGTTCATGTGCTTTGGCTCCATCTGTCTGAGGTTGAGGGCG
TTGTATCATGTCACGACTGACTTCTGTGTGTGTGTTTCGTATGTATGCCAGCATCCGACAACTTTGGCGGCGGCATCTATGCGCAGGAGACAGGACAGGT
GGTCCTCGTGAACTCGTCGATGCTAGACAACTTTGCCGACGACGCGGGCGGCGCGATTTACCTCGACACGGGCGACAGTGTCGGCGCAACCCTCATTGGG
ACGCTCATCAAGGGCAACTACGCCAGGGGTCAAGGGTGCGGTGTCTTCGTCGGTCGAGAGGCGTTCGTCAAGGCCACGGACTCGATTTTCTCGTCCAACG
GCGGTATGTCGTCCACGGGCAAGAACGAAAAAGGCGGTGCTGTCGCGTCGACCGAGGGGCGCGTCACGCTCGTGCGCTGCAGCCTGGTAAATAATACGGC
GATCATTGGCGGCGCACTCTACGCACAGGACGGCATCATTAGTATCACGTCGACCGAGTTCCTTCGCAATAGCGCCGACCAGCTCGGCGGCGCGATTGAG
GCGACCAAGTTGGCCACAATCACCATCGACGGCAAGTCGAGCTTTGCGCTCAACGACGCTGAGAGCGGCGGCGCGATCGCGATGACAGATCAAAGCAATA
TATCGATCAGCAGCACCACTTTCACCGACAACTTGGCGCGCATTGCTGGCGGCGCCATCTACGTTGAAACACAAGGATTTGCGCGTGTCAAGAGGTCGGT
GTTCGTCGAGAACAAGGCTGTGTTTGGTGGCGCCGTGTACATCAAAACTGCCATAGAGTCGACGATCACGGACTCCGTCTTTTCACACAACAATGCGAGC
GCGCGCGGTGGTGCGTTCTATTTTCAAGAAATCCCGATCAACATGACCACGTCGGTGATCACGTGCCAGCACAACGTGGCAGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCATCCA
CGTCGGCGCCGCCACTTGTCCCCTGTGTCTCTTGCTTGATGCTCAACAACTCGCTGTACGACATTGCAACAAATACGCGCACTGTCGGCGTACTCTGGTG
GCCGAGCGACGTCTACAGCGGCATGGCAGCGCTGGAGCTACCTGATGAAGAATCGTTCAAACCTATGGAGACGCTGAATATGAGCAAGGCGGAGCTGGTG
CCCGTGTGGCCACGACTCAAGACACTCGATCTCTATGGCCAGGTCGAGGTGCTGGACGCTGAGACCGCCTGCATCGTCATACCAGTGATTGATCCGGACG
GCGCCCGCGTGGACTTTAGACCCATCGACTTGACCACTGCGATTGCGGGCGTCGTCTTGTACGAGGGCGCGACATTCACGGGCGAGGCGAAGAGCGAGAA
GTATGTACTCAACGTGACGTGCTCGCTGCCGAAGCGCGAGAAGGACGTGTTCTTCCTTCAGAGCGTGAGCGTGCTGCCTTGTGAACAAGGCTTCTCGATC
GAGAACAAGTACGTGGCCTAGGTGTGGTGATGATGTGTGCTGGCTTACAATTAATGCTTCGCTCTCCATTGTCCTCTGTCTATTAGCAAATGCTCTCGCT
GCGCAAGGAACAAGTATAGGTGCAACTCGGCCAACACAGTGTTGCTTCAAAGTGAGCCCTGCTTTTCTAACAGTGATCTCTTGTTTCTTTGCTCTCTCTC
TCATAACATGCAGTATGGACGGCCTTCGCTGCTACAACTGTCCGACAGGCGGGCAGTGCGACATGACAGTGCGCCGCGCGACCGAGACACTGGGCACCGA
GTATGGCACCGCGTCGCCACGTACCTCGGAGGGATTCTACCTCTTCGAGGCGCCGCAGTCCAAGAAGAACCGCAGTTGTGCCTGGACGGAGTGGAAGAGC
GACGACCCGTGCAAGTCGGTCGCCGAGAGCATGCCGGGCGCGAACCTCACGCAGATTCTCCAAGCGTGCGCGGCGTCCACCGTGTTCAACAAGCACTGGT
CGGCCGACCGCATCTTCTCATGTGTTGCCGACAAGGCCTTCTACGTCTGCGAGGTCGCGGGCGCGTGCCAGTCGGACATCACGGTCGAACTTCAGTCCAA
CCAGCCAGCGAACAGCTCGTGCGCGCCGGGGTACGACCAGGCGATCTGCTCCGTGTGCGCCTACCGGTACAAGAAAGTGAAAGACAACTCGTGTCAACGT
GAGTATTGTATTCAGACGAGCTATGCTGAAGTTGTGACGCCTCGTACCTTGACGCTGGTTGTATGTCTTTCTTTGGTCGTTGTTACTACAGCCTGCGACA
AAGCGAACGCCGAGGTGCGTGCGTCGATCCGGTGGCAGAACTTTGTCATTCCGACCTTGATCATCATTGCACTCGTCGCAGCGATCGCCAGTGTCCGATA
CTATCTGCGCGACCTGACAGAGATTGCACTGTTGGAGAAGGCCGAGGCCGATCGGCGCCTCAAGCCACCGGCGCTCGAGAGACGGCGCCAGAGCGTAGTC
CAGATCGCGAGGGAGCGCTATCGACGGCAGTCGGTCGTCGTGCTTTCGCACTTCGAGCAGTTCAAGAACCGCTTCAAGCGCAAGCCCAAGAAGAACGCTA
AGATCCTCTTTGGCGTCGAGCTCGAGCCGCCGTCGCGCCCGTTTCCGATCAAGCCGGGCAAGTTCAAGATCTTCCTCGGCTTCTTCCAGATCTTTGGCAA
CTTCCGCGACTCGTTCGTGATCAAGTGGTCCCCCGATATCCAGCGAGTCATGAACATCTCGCAGCAGTTCAATCTGGTGCGTTCTTTTTTTGTTTTATTT
GTTGTCCTCATTAGTGAGATACTGGTTGTCTGCATGAGGTGGACAATGAGCTGTTTGACGGCGTCTTGTTAACGTATCTCGCTACTCTTTTACCTGCTTG
CATTCCTAGGACCTCGTGGCGATCGCTGGCATCGACTGCGTCATCCAGACCGATTTTTACTACACCTTTATGTGAGCATCTCTCTTATCTCTCTTGAGAT
ATGTCTCTCTCACGTGCGTTCAGCCAGCTAACACTTCTCATTCTGTCTTGTGTGTGAAAATCCCACAACAGCGTCACGGTTATCCTGGTCGTGCTCACAC
TTACGGTGATCACCACGTATTTTTACGCGGGTATGCGCAGCTACAGCACCAAGTTGCTGCTGATCCCGCGCAACTGCCTCAGGTGTGGCTTCCCCGTGCT
CGAAGGCGAGAAAGTGCGCAACGACGCTGCGAGCATAAACCCGCTCACGCTGACGCGGATGTGGTGGCGTGGGCGACAGGGTCTATCCCATGTAGACCAG
CCGCAGTCCGCCTCACCAGATCCGAGAGCTCGTCGCTCGAGCGCAGTGGCGGTTAAGGCTGAGGCCAGACGTGTGAAGCGCGAGTACGGGATGTCCCAGG
TGAAGACCCCGAAGCTCGGGCTCTTCCGGTCCGTGCACACCGAGTGCCCGACCAAGCAGGTGCTGAGCGGCCGGATCCTCGAGCGCACGATCCGCAGCAA
CCTGCGCGTATGGCAGGCGCGCGTCAAGCTGCGCATGAACTACCTCACGTATCGCAACAAGTGCCTCAAGCTCTACTGCTGGGTCGCGCTCTTCCTCTAC
CCGACCGTGTCAAAGACCATTCTGATGATCTTCAACTGCCAGGAGGTGGGCGACGTCCGGTACTTGATCGTGGACCGGAGCATCGTGTGTTACAACTCGA
AGTGGGCCGCCTTTGGGGCCATCGCAGCGGTCGGCATCATCGTTTGGGTCGTCGGCATCCCGTTCTTCTTCTGGATCCTCATCCGTCTAGCGCAGGACCG
CGGCGTAGCCGAGCGACTACGGCTGCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAAGAAGTGGCTCAACGAGGTGCTCGAGCAGCACGTCAAGGATGGTGTGTGCGTGCAGGAGATGGACA
GCATCGATGTCCAGGACCAGGAGATCGAGAAGTACATGAAGCGCAAGAATCTGGCGGCAAGTAGCCCATTTTGTTGTGTGGTGTGAGAAAATGGTTGGTG
CTAACAACTGTGTACTTGTGTGTGTGGGATTAGGACTCGACGGTGGAGGCGCGCCTCGGGTTCATCTACGCGGACTGTATGTTTTCTCTTCATTAGTTGT
GTTTGTATGCTGGTTGCTGATTCGTGCTGTATTGTTGATCAGATTCGCACGCGTTCTGGTGGTTTGAGGTCGTCGACCTCTCGCGCAAGCTCTTCTTGAG
TGGCGTGATCGTCTT