Description :
From Genome Similarity Track
Location :
Scaffold_824:3014- 4137
Sequence
1123 bases(100 bases per row)
TCTCAACTTTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAACTACAAAGGCAAGGGAACACACCCGTAAGGCAACCCTACGGCCAGATC
CACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGCTTCGGAACAATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCAT
CCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGG
AAAGTTCAGCAGAACACAGGTCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCCAGCAATCTCGCAGATTATGCTGA
TCCCGGTACACCACAATGGTGCGCGTGCCCGTTTCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGG
AAGAGGCGTCGTCGGAAGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGA
GGTGGATCCGGATCCGGATCTAGAAGAAAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACA
AAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGTCAACACCGTACCTAATCCCAAGCCCACTAGTCGAAGAAACGAGAA
AGAAGAGGAACATGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCA
CGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTTCTACATCAAGATCCTGTCATGCAGATTCTGAATCCACGACAGATCGAAGATCCAAGGGAACCG
GTGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAG
AGGATATCTTCGAGCTAGACTTG