Description :
From Genome Similarity Track
Location :
contig_38:301377- 316767
Transcript NameFunction/comments
g7111.t1acyltransferase, putative
g7112.t1hypothetical protein PHYSODRAFT_551932
g7113.t1glucokinase, putative
g7114.t1RNA polymerase II-associated factor 1
g7115.t1conserved hypothetical protein
g7116.t1conserved hypothetical protein
g7117.t1AP-4 complex subunit epsilon, putative

Sequence
15390 bases(100 bases per row)
ATGGGCCTTGAAGTCGACCTGCTGTATCAACTTCTCCATGAGGTGAGCTGACGTATCTGTAAATAATTGATTGATTTCCGCCGCTCGCTCACACTGCGTG
TCTTGCAGCTTTTCTCCATGCATCAACGCGAGATCAGGGCAAACATTGCAGCCTTGCCGCCTCTCCAGCAACAGGAGACGAGATAAACCCGACCGAGCTG
AGGAACATTCTGGGCTCTGAAGAGGAGGAGACGAAGGAGGACGAGGGTCTCTAGCAACTGAATCAACAGCCTTGGCCGCCGCTGCAGCCTCTGCTGACAG
TACCCCATCGGCCTAAGAACACTTGTGAATGAGTAATCAGTAGCGACAGCAAGTATCTTGCCACAAACATGCATCTCAAGTGACTTTTTCGCCAAATACA
TAATTTATTTCAAATATTGCGGAGCTGACTCGCAACTTGCTGGGAAGCGGTAGCTTGCACAAATACTTGCTCGGACTCCCAGCTTAAAGGCGGTGCTGAC
GGTTGGTACTCATGAGCGAGAGGAATGGGATCAATCGTCGGCAGCGGGTCGTAGTTTGTGACCCCCAGCAACGGCTCTTCCATGTCGCTCTCCATCATCG
TAGCGCTCGGAACGCGCGCCATCTGATGGTGCCGCTGCTTCCGGAGGCAGCAACGGCGGTACAGGAAGCAGAGAGTAGGAGCTGCACAAAGACGCACGAG
CAACGAAGCACACGAGCATAGCATCCGCCCACTGCATCCGCTGGAGCCGGGCGCTCTGCTGCAGCGAGGAAGGCGCGTCCGTGTCGATCCACATCTTGAA
GCACGAATTGGCAATTGAGTTTTCTCGCACAAATTTTGGGTGGGACCAAAACTTGGCAAAACTCAAGTCGCCGCGGACAAGTACCATAAGTCATATTCGA
GCTGCAACGTACCTTGGCATCCAAATGATCAATGGTTACGAGTGCTTGGGTGGTGCAAATGTGACGGGTTGCGGCACGATGGACCCTCTAATGCGCCTTA
CATATTACGGATCGTGATGCAATTGACCAATGCACGATAAACATGTGCAAATTCACTTCATTAAAGCGCACAGCAGACAGAATTACATCCATGGTCTTGT
CACTTAGCCACTGGGCTGCCCACCACCTGGTCCATGAGTGAATTCTCGATAAGCTCCTGGCTGGCCGTGATGCTGTTGGCAGCAGCGCCCATCATGAACT
TGGTCATGGCTCCCATGACGGGGGAGTCTTTTTCTGGTTGCTCTTGTCCGTGCTCGAGCGACACCAACGAGCACATCTGAAGTAGACACCGCGGGCCGAC
GGACTGAGAAGGAGGCACTGATGAACGCTTGGCGACAGCATAGCATTGGTGGCGGTGTGTCAGCCCTGCGAAAGGTTCGTCCACCACTTCCAGAGGAGTT
TTGATCGAGATAAACACCACCACAACACGGTCCTCCTCCACGTAGCGGCGAAGAACTTGCTTGACACGGAACATAGCGTGCGTCGAGCCAACGTACATCT
CCTTCGCGAAGTTCTCGACGATTGTATCAGATTCGTCCATGACCTACAGTGCACATACAAGTTCCAGGTAAGCAACGAAACTGATGCTGCTAGCAGCGAC
ACTGTACCTTTGCAGTCTTCTCGTACACCTTGCCTCTGTGTTTGTCAGCGCCCTTGAAGTGGTCCCATACCGCCTTTGCAGTGGTGTCCATATCAAAAGG
AAGCACTTTGTTGGAGAAAACGTCCAAATAAATGCCATCGTCTCCATCACGCATTTGGGTGTCTTTATATGTGACCTCCATCGAGTTCAAGCCATTTGTG
CAGAATACAGCATCCATCTCGCGGTATGCACCCTCCAAAATCACAAGCATATCTTCAAAGTCGCCAAGATCCGACTGGTAGTTCACCATACGACCTACCG
CGAAATCGGTCGTGTCCGGCGACACAGTGCGAGAACACTCCATAAGCTGCACAATCAGCACGACTTGACGTAAGAATCCAAAACAACTACCAAATACAAA
CAATAGCAGCCGCCATTACCTGATTCTTTGCTCGCTTGAGTAGCAGCATCTGCATGCTCTTGGCAGCTTTGAGTTGGCTCTCCAGCACGAGTTTCAGCCT
CGCATTCTCGATCTCTGCTTTCTCCCTGCGCTTGCGTTGCTGTTGTGCCACAGGCTTCCACACCGATTGTTCTGCAACGGACGAGGGCACCAGGGCGCCA
TCATGGCCCGCACTTGCATCTTCGTGCCCATCCTGCTTGATCAGCTTCACGGACGTTCTGTGCTGCTGCAGAGTGTCCAACTCGGCCTCCAATTGGGCCA
CTTTCTCCTTCAAATACGCCACCTCAATGCGGCGTTCGTTCCTGGCCCGATTTGAGTCGCCAGTCACCCAACTCTTGCGCAGCAGCTTCTTGGCCGTCGA
TCGCCTCGGCGCTCGCGTGCGCTTGGGCTTCTCGCGCTCGATACGACGTGGCGACCCGTCCTCGTCAGTCGTTGTGTGGTGGTTCTCGCTGTTCGACGCC
GGTGACGACATTGCGTTGGGGTTCTGAGGCGACGAAGCAACCGACGAGGGCGAACCCGTGGAGCTCGGGAAGCCCAACGCCCACTCCATCTCCTGCTTGT
TCAGCACCTCTAGGGGTTGGATGGGAATGGGCGCGTCGCCGTTGCCGTCCGCGAACTCGTCCACGAAGGACAGTGCAGCTTCGAAGGCCGCCATCTCGTC
GTCCGCCAGGAACGCCATGGCATGTGCTTCTTTGTCGACGCTGTTCAATACTGAAACATGAATTGATTGCTGAATTCCGCTGGTGCAGGTTTTCGGTCAA
TGGCAGGTGTCAATGATCTGGATATCTACCAATGAGTGCATTGTTGGACCTAATTGTTGAAAAAGCAACATATCCGCACTGAACCAGGACGCGGCATGGA
TCGGAGAATCTGGTTTGAAAGTGGACGTGAAGGAAAAGTATTAGTACGCGCGTAGGAAGCCTACCGTCCAGACGGTTGAAAGCCGCAGGTCGTCGTGGGT
TTGGCCGCCGCAGTGCTGCACAAACTGCTGACACAAGCACGCACTAGCAGAAACTGCATGCTGCAGCATGCTGTATTGGTTGCACTGCATAATGATGCGA
CGAGCTCTCCGCGCAGCATTCTGCTACGCACTGCACTGCGTAGGCTGCATACTATACGCAATATTCAATTGATTGTGTGCTGATAGTATAATGGGAACGC
CTGAGGTTGGAGGATCTGAGGGCTGTGAGGGTGGGCTGGCGTCGTCCACTCCGAAGGACAAGTTAGGCAAGCCGGTGGGTATAATGAAGATATGTATTAA
AATATTAAGAAGGCTGTACAGGTCACAGTGTGCAATGACGCCGACGCCGCTGTCTTGGCGGAGTAGCCATCACGTGACTACCTAGACCAATTGAAAAAGC
AAGCGCTGGATATGGTTCGGGTATCATTGGCGCCGTCGCCGTCTGCCAGTCAGCGCTAGACAAGTGGAGATGGAGACATGAGCGTGGAAATGATAGATGA
GTCTTTGGTTGATACATGAGTTTGTGGTTGTCGAGCAGAGTGGAAATGTACATGTCTTTCAAACTCGTTGACAACGGGACCGTTGCACTTGCGGTGGGCT
TGGCCAATCAGGGTCCGGCCATGTGGTTTTGCCAAGCAAGCAAGTTCAGAGGCGCCTCATAATTCAAGCGGCGGTACGTCGAGCGAGTGCGTCGAGTGTT
TCCAGACCATAGCAGCATCGGACCCAATGACGGCAGCTGTCATGTTCGCGGGCGTGGACATCGGGGAACGGGCGTGAAGGTGGGCGTCGTCACGTCCGAG
GGCTGTGTAGTGGCGCGCGAGCAGAAGAAGTACCACCCGGAGAAGCACGAGCCGCAGGACGTCGTGGATCTTGCCGTCTCCGTGCTGCATCAAGTGCTCA
AGACGGTGCGTGCGTCGAAGTTGATGGTAATTAGAGTGAGGTGTCTCACCAGTCGTCTACCTCATGCTGGCAGACGCGATTGGGATTGGGGACCTGGAGG
CGGTGGGCGTCGGCTGCCCCGGCGTCCTGGAAGCTGGGGGCGTCATCCACGCAGCTGCCAACTTCCCGTTCTGGTTGGATGTGCCGCTCCAGCAATTGTT
CACCGACACCCTTGGCAGACCGGTTAGTGGGGGGTGTTTGGGTCTGTGGCTTGAGGAATGTTATGGTGCTGACCGAAAGTGTAGGTTACTGTGTGCAACG
ACGCGGATGCTGCCATTTTGGCGGAGCAGTGGGTCGGCACAGCCAAGGGTGGCATCAAGGATTTTATCATGCTCAGTGCGTTAATGTCGTGTGGCTTTCT
TGGAGAAGGTTACGATAGGCCTGTATTGACCGGCTGATTTGGGTGTAGCACTTGGTACGGGTGTAGGATTCGGTGTCGTTGCGAATGGCCAGCTTGTGCG
CGGTGGAAGCAATGCCATTGAAGGGGGTCACATGGTGCGAAGCTTGCTAGTATACGGGTTAAATTGACCGCTTGTCGTAGCTGAACGTGTGCGCTTGTCC
TTGTAGATTGTGGAGCGCAATGGACGACCGTGTGGTTGCTCTCAAAGAGGTTGTCTTGAAGCTTACAGCTCGGCGGGCGCATTGATGTCGCAGGCTCAAG
AGCACTTGCGCGCTGGTATGATGCTGGAGCTGTGTGTTGATTATAGGAAGTGAATACCTAACGATTCTGTCCACTGTGTTTGAATTATGTAGGAAGGGAT
TCGAGTCTCGCCAAATATTCGGAGGAAGATATTAACGTTGAATTCGTCTTCAAGCATGCCGCCGAAGGCGACGAGCTCTGCAAGCATCTGATTGAAGAAG
TAAAGTATGGCTGTGGCACCGCCTTATGGTTTGACTTACTAAGTGATGCGAAACTAATTGTACAGGCTGCCGACTACTTGGGTTTTGCCTGCGTGACCTT
CTGCCGAATGTTAGACCCGGAGGTAAGGATGTTCAGCCATGGAGACAGTACTGCAGAGATAACCCTGTTTCCTTGATTGTGGCAGATTATTGTTCTGTCA
GGAGGAATTGCCGAGGCTGGAGAGACCTATGTTGAGCAAATTCGTCGTGCCTACGCGAAGCACACGTGGACTAAATTCCCCAACCCGGTACGCTTGGGCT
TCTCGTTCCAATATCTGTTTCGATGATGTCTAACTCGTGTTTTATGTTATGTGTATAGGTTCGTATTGAAAAAGCGAGCGCGGGGTATGATTCGGGCATC
ATTGGTGCCGTTGCGGTATGCAAAAATCAACGCAAATGGCAGTGAAGCTTCGTACGGTGCGTATGCAGGCAGATGAGTAAGAAGTCCCAGCTTCAGATAT
CGATGATAGTTGAATGAAGTCTCTGTTTGATGTAATGCTGGGTTTATTTGATGATCGCGGAGCGGCAAGAAACAAATCACTTTCAGGTAGTGTGTATCGA
AGGAGATGCCGCATTTCCTATCTGTCCTGAAGGAGCAGCTAACAATTGCCAATCAAGCTAGTCACTGTCGCTGTCGCTGATGACGGGGCTGGCATTACCG
TCGTTGTGTAGAACGGGGCTATCACTGCCATCGTTTTTGCCGCCAGCGGGGCTGTTCGAGATCTCCGGTGAGCTTTCAGGGGGAGGTGTGTTTGCCTTGT
TTTCCTCGTCAACAGAAACAGGCGATGATCGCTTCTCTCCTGCCCGTCGGCGCTTGAACTCGCGCACACTCTCATCGTCATCAAGCTGGTCGTCATAGAC
TCCTCCGCACTCGAATAGGTCCTGGGTACGACGGTCTGTTTCGACTTCTGAGTAATCCCGACGGTAGACAACAGCTCCGTGGCGACGTTTTTCCTCTCCA
GTCATCTGCATACAGGAAAGCAGGTAATCGTCAGAACAGCAGCGACGCGAGCCCCAAGAGCATGAACGCACATACCTTCGTCTTCCTCAGCTGATGCGGT
TCAGAACGTCACTGTATGTGAAATGGTCGGACTCCGGGTCTAGCATGAACATAACATGTTGTGACTCCCTCTGAGGCAGCGAACACCAATAAACAGAAAT
AAATCAAAGTGAGCACAACAATTCAGCTGAAACAGAATCAAAATCGCCAACGTACGCTATCAAGCGACTCCACCGCCATAAGATACTCGCGGAGGTACGA
GAATTTCTCGCGATCGCTACTGTCCTGTGGTAGAAGAAACAATTCACCCATTAGCTTGTGCCGCGGTGCTTTAGTGCATGCATAACAGGGGTGTACCTCT
TCTTCTGCCGATCCGTTGGGCAGCAGGATAGAGCCCTGAATAAGTTCCTTGCCAGCTTGGGTCTTCTTGTTTACGCCGCACAGCAGTGCACGATCCTCGC
GGCTTGTGATTCCCTTGCTCTTGACATCTTCGGAAGGAAGAATATCGTACGACTGCAAGTCCACAGAAATTAGTATCCTGTCAGCTTGTGTCATAACGCA
TACCGAAATTCCGCTGCGAGCAGACGTACCAGAATTGCATACTTGTTGGCAGACAAGAGCTGATCGGGGAAGACATCCCACACCTTGGCGATTTTTTTCC
TTTTGCTGTGCGGGTGCACCAACAACTTTGGATCGTTAATGTCGCGGAAGGACGCTTCGGCACGGTCCTCTAACGTCACGGACACAACCTCGGCCAGCGC
ATTCTCCGTGCCCTCACGCAGTGCACTCTGAATTTCTGCCTCGCTCTTGAACTTGTGCACGGAATCGTACAGATCGTTGCCCATGTACTCCGTGCGTCGC
AGCCAGGAGACTGTGGGGCGCACCTTAGATCGGCCCTTGGTGCCCATATGGTCCTCCTTCATCATCAGCGCCTGCTCATCGCCAACCTCCAGCGGCTCGG
GGTCCGTCGGGGCTGCAAAAATCCATCCGCGACATTTTAGCACAAAATTCTACATCCTAATCCCCCAGATAAGAGTTCTACCTTCATATTTGGCCGGATC
GATGAGGTCGATGGTCAGTCCGAGGTTCGGCTCCTCGTGGATCTCGTACGTGTAGTCCATCTCGAGTGTGTTGGGCTTGTACTTGATGAGTCTGTGCACA
TAAACCACCACCACATCATCAGCTTCTCCACCTTTCTCCCATTCTGCAGCTCGCCACTGTCGCACCGTTCCGGCTCGTGCGGGTATTTGACAAACTTGGT
GTCAAACGGGATGTCCGGCAGCGAGTTGCGGAACTCGAGGCTGGCCAAGAACTCCGACTGCTTGCCCAGCAACGCGCGTCGCTTGGCTTGCGCGTGGCTC
TCCAGGATCATGCGTGTGTGGTCGCGCCGCGCTTTGAGTTTGTCCTCCTTGTACTTGGCCACCTTCTTGCGCTCCAGCTCATAACGCGCACGTTCCTCGG
GTGTGGCATTGGCACCGGGGGCGCCCGCCTTTTCCGCGCCTCGTCCTCCTCGCGACTGCGGCCGTTGCTTTTGCTAGCCGCCGCGCCGTTGGCCTCCGTC
GCTGTCTTCACCTCCGCCATCGCTCGAAGCTCTTTTTGCTCACTCCCCCTAAACCGAGAAATGTGGTGGAGTCTAATTTACGTGGTGCACATCATCATAT
TTTTGTCACTTCAAACGGCGTTTCGCGCAACAAATGGGCTGTAGTCGACTCGCCTATTAGCCATGAAGCAGCTGCTGATCCTGGTGGCGCAGCACCCGCT
CAAGGTCGGGTCCGTGGTGCTGCTGCTCAGCGCCTTCTACAGCTTCGCGCGCGTCCTGGTACTACAGTACGTTGTGGGCTCCGTCCAGGACGCCATCGTG
CGCTACCCGAAGAACTTCCCGCACGCGTTCTTCCTCCCGCTTTTCCACGTGTCGCTGGCGGTGGCTGCTGCTGCTGCATTGTATCAGGACTATTGCTACA
ATCGCTTCTGGAGCTCCTCCACACCCACGCAGCTCTGGAAGCACGTGCTGCCCCTGCCGCTCACACTGCACCCCGGCAAGTGGAGTCGGTTGGTTGGCAT
CCCTTTGTACGCGTTCGGCATTGCAGTTTTGGAGGCTGTGCTTGTGTTCAGGGACCCTACCATAGAGAGTGTGGCCAAAATGGTCACTAGAGTTTTGTTG
CAGCCGCCTCGAGAGGAGGGGCAGGTACTCATGCCAAAACACGTTGCAGGCGTGCTTTTTCAGGATCAAGCGGAGGTGGCCTGGAAAATACTTACAGGAG
GTGCAGCAGCTCAGAAGTCATCGACGCGTACGTTTTCGTACGTACGACTGCTCGTTGAGATCTTGTTGGCTGCGGCAGTTTGTGTAAGCTTCGCTCTTGC
GCGGTTCTTTCGAGAGCCTCAACACGGTACGTTGCCGCTGCTATTGCTGGGTTAGTTTCTGTATAACTTACGCCTTGCGTAAATACTTGTTGCATTGGAG
TGATTAGATGGGGATGAACTGCGCGAAGCTGCGAGAAACAATGACATTCTAGGAGTGAAGCTACTTCTTGCTCGGGGGATGGACCCGGATGCTTGCTCTG
GTGATGGCACGACGGCATTGCACGTCTGTGGGCAGCAAGCAATTGACAGGGCCGCGCAGGTTCTTCTTGAGCACGGGGCAGACGCGAACGTAGCTGATCG
ACTTGGATTTACGCCACTACATTGGGCTGTACAAATGCGACGAGAAGAAGTGTCGACTTCAAGCCGTTTGGCGACGATTCGAATACTGCTGCACCATTGC
GCTGACCCACGCAAACCCGACTCAAACGGCACAACGCCGTTAGTAATTGCATCACGAAAGGAGAACGAAGCATCGTTGGGAGTGCTAAAGGAGTTCTTGC
CTGAAGGTGAAACTGGTGGAGAGGTAGAAACCACCGAAACGATAGACAACGCCAGCGTGGACTTGGCAATTCCGAATAATTAGCAAAATTACCACTCATC
GACTACTAAATCCCGTGACGTCCATCTCTATTACCTACCGTTGACACCACAATCATAAGGTCTGCGTTAGTTCAATGTAACCCAAACGCACGATGCCAAA
GCACGTACCATTGACAAAATCCTCTCTAGCTCTGCCTTAGAAGGATAGAGTGGTAGATCCAGCCTGAACCAGCAAGGCAGTGGTCAACAAAGCGGCTTGC
AGAAACACGGTTCAAAATATGCACTCACCTGTTCAAGCACGTACTTGCATGCGGTAGTACGGTGTACACGGTTGAAATATCCTTCCCAAGCTGGATTGTG
AAAAGTTGGATCTCGCCATCCATACCAGTCAGACCCTGTATATTGAAGGTCAGAACCAAATTCACTTAACGCGTAGTGAAGCCGAAAAATATACCTTAAA
GCCTTCGACAGGAACGCCGCTGGAACCAGTGACGTACTGCAGCAATCTTCCGCGTTGATCTTGCGTGAACGACTCTAGAATTTCCCAAAACCAGGCAACC
AATTCAAACTCGTGACTACTTTGTTCGTAGAATCGAATATCTGTGTGCTGTCTCCAGTCATTGACATCGATTTGAGGTAATCCAGAGAAGAGTATGTCAA
GTTCCTTGAAATCAAATACGTGAAGAACTGAATCGCTGATGACACTGCGCAGACCCTCCATGATGCTCGAAATTTCCGCTCGAACACTGTCAAACAGATA
GTACTGTGCCACTTTTGCAACGTAAAGCTGTTTGTTTCCATCGTGAAGAATGACATCGGCGCCATTTGGAATAAGTTCTGCGCCATCCACCGTGAAGTTC
AAGCCGAGAGCATTTGTGTTATCGTTTTCGAGGATCCACATCATACTGGAATGCACCGTTTCATCGAGCAGATATAGGTCTGAGAGCTTGAGTGGCACGC
CGAGAATGTGCTTCAGCAAAGGGACGGAAAGCCGCACGTTTAGAAGTAGGCCTTCAAGCAAAGCCTTCCCCAATAGCTTTCCGAAGAAGACGTACATCTG
TTATTATGAGCATCAACCACAGTTAAAAATTTGTGATGAGCAAAGAGGCAATGCTTTGGACATACCTGCAGCTGCTTCGTGCATTTCCCCGTCGCAGTTC
GATTAATCCAGTATCCCTGGTGCGCTGCTGAGCTGGTTAGTGTGAACAGCCCCAGAGATTCCGCAAAAAGCTGGCTGCAAACAAGATGCAGCCACTCCCG
CAAAATGCCACCACCATCGACGCCAACCTCATCCATAAAATCGACGCGTAGTCGGCGATGTAGAGTTGCATCCGGTGCAGACATAAAGAGAGTCATTGAC
TGCTTCAACACCCTGTCACGATGAATGCCTGCAGCTTTCGTCAGTTGAGCAACCTGAAAATCACAGCCACAGCTAACGTACGTATAGTATGGTAGCCATC
GACAATGGACGAGCAGAGCTTGAGCGAATACTGGTAGAACCACTGTGCTTTCTCGGAAAATGGCAAGGTCGATACTCGCTAAGAGAACCGCGCACAAAAA
CATTAGACAAGAGTGATAAGGCTTACCCGACGACTGGCTTACCATGATCGTTTTGGAGTATGGTCGTGATGAAGTTGAAAATTCCTCGGCTAAGCGCCAG
CGCACAGTTCGGCTTCCCGAGTGTGAGTCATCTCGCACGAATGCAGTTCCTGGGGTGAGCCAAGAAAGTTGTTTCCCACTGCTGTCCGAAAAGATGACAG
AGGAAACAGACATCCTCGAGGACCCAGGCACCTGTGGAGGGTGTTGTATTTCCCATTCCTGAAAGTCACGCTCTCTAATAATGACGCTGCATAAAGCCTT
ACTCACTTGGAGAGCTTCAAAAGGAACGTTTACCTGTAAGACCCAGAGTGCATAACATTAGCTATACAGATCATTATCGGATCCGAAACTTTTCACCCCT
TACCCAGCGCACATGTTGCCCTCCAATACAGCGCTTCCACTGATGCCGTTCGCGTGCAATTAACTGACGGTCCGTCAAATCTTCACTAGGAAGAGCGTTC
AGACCTCGAATCCAGGCAGCACGAGGAGAGGACATGAGGAGATAGTTCGAGGCCGAACGCTGGCTGATTTCACCTTGGGGAGCGCTCAGTATGGAAGCAC
TCGCATCTTCCTGTCGACTTCTGATCATCTTTAGCTCTGCAATCCACGAATCCAGCACATCAGATCACAGATAAACCATGAAAAACAAATTCAGCTTTTC
AAACCTTCAGCCGTAGTACCGCACAACACACAGTCGGTCTGCGAAAACTCGTTTGTGTGGTAGCAGATCTCGCATCTCCATCCAGCATTTCTACAAAAAT
GCCACGACACCGGAAAGATATAAATCCCCGATCTCACTTGATCCCCAACGTTCAAAAAGACTCACGATCGTTCGATGAAGGCGCGGTGGCGCGACCGCCG
GCTCGAGCTCGTGCAGCACTCCTTACAGGCTTTCCACGTCAAGCATAGTGTGACAAGCACGAGGCCCACGCCAATGCTGACGCCGATGATCACCGTCTTC
GAGCCGCTGCTTCCGTCGGAGCTGCCTCATCATCGTTGTAGCCGTAGCTCCCGTCTGTCCAACATGAGTCCATGCCATCAGCACCAATCTCACCTCACTA
GCTCTCACATTGCACCGTACAGTGGTAGTCGTAGTCACCGGTCGTGTTCGAGTAGGTGCCGTCCAGAATGGGCATCAAGCCGCGCAAATCCACGCTCTCC
TCATGTTGCGTGCTCTCCTCAGTTGGGGCTCGGCGCCTGCGTCCATTGCAGCTGCTGCACCATTCAGTAACCCAGCCAGGTGGCGACAATGACGAGCGAC
GCCAAGGTCCACAGTCGCCTCGCCATCGCTGCGACTGCAGCAACGTCTGTTGCTCCTCTTCGGCGACTCGTTCCGGCCGCTCTCCGACCGCGTGTCAAGC
TTCCTGCGGCGTCCTCTGCTGGTGCATCGACGACCTGCTTGCGCATGTACAGTCGACTTGCTGATTGCAGAAATGGAGTGACGAGCTTTCGGCCAATCGC
GTTTCATACAAAAATCAAGTGATAACGATTCGGATTTTCACGGAACTGTAAGTCCGCCGCTCACACGTTGGACTCAGACAAATCCCGGCGGCAACCGTAT
CGACACCAAGCATCTCTACACAACACCAAAATAATATTTACAGCTTTTTATTCCTCTTTGTGACCTCGCAATGGCCTCGCCTCCTCCTTCAGAGTCGCCG
CCGTACTGGTCGAACTGCGTTTACAATTTGAACAGAGAACGCCGTCGGCCGTCGGGATATGTTGCTGCCTCCGATGCGGCGGCCCGGCAACGACCCACAG
CGTCCGTCTCGCATATCACTCACTCTCACATACAATGGAAGCTCCATCTCCTCTTCTCCTTGGTAGCCACTGGCTCGACGAATTCATTCTCACACGAGCG
CGGCAGCACCCGACCTTCTCCCGTGTTGCAGTCTCTCGTTCGGTCGGAGAGTGCATTGGGGCTGGGCAGCCTAGTAGGTGGCAGAACTTGCGCAAGCACC
CCATCGTGGAAAGCACTGGGTCCGAGCGCACGGTGTCGATGAACGTCTGCAGGCGGGCGTTGAGCACATGGTCCGTGAGCTCAGGCTGCACGAAAAGCAC
AGCGCCGCTCGACACGTGCGGCACTTTCACTCCGCGCGACGCCTTTTTCGCCTTGACCTCCTTCTTCAGCTCGCGCTCGAGTTGCTTGAACTCGTCAAAG
TTGCAGTCACGTCCCACATGACACGGGGTTCATGTGCTTCTCCTGGCCGGCCGACTGGGCACCGCAGTCCACGCGCATGACATAGACGTCGCGGGTTGCG
CTTGCCGGGCACGCTTGCACGAACGCCTTGCCCACACGAATGTTCGCTTCGCCTAGGTTCATGTCGACGCGGCGGCGCATGTCACCGGGCACCACATTGA
CCAGGAGGCGATTCTTGTTCAGGTGCGCCAGCACACGACGTCGGGCAGCCGGGGCCTGCCGCTCCTTTCTCTTGGAAGCGGCCGCATCGTCTGTCTTGTC
GACATGGGTGGACTTGGACGCATAACCTGCGCCAACGCGGAGCAATGGGAGCGTGGAGGCTGTAGCAGCACCGGCTTGGCGATGTAGTAGTTTTGAACGG
AGGCCGCGTTGCGTGAGGCATTCATGGACAGCATGGCGCAGCCCATGAAGGTGTAAAAGCTGATGAGCCCGAACGCCGCCCTGCACCAGGAGCGTGAGCA
CGAACGCGAGGACGTTCCAGGCCAGTACGCAGGCGACATAGGTGGCGAGCAAGAGCGACGCGGCCGAGCTGAGGGTGACGTCGAGGTGCACGAGCGAGTC
GTAGGCGCTCGTGAGCACGGCGAGGCGGACGCCCGGCAGGTTGAGCACGATCGTGGGCTTGGCATTGTCGGAGCTCACGGCGCGGGCGCGGGTCTTCATG
CTGTCTGTTGGTGGCATGGTGGCCTCGAGGGTCTTCGCAATGGCGCGAAGGAGTCGTACGTTCAGCGCTCGCAACTGAGCCCGAACGTTGGCGCTGGCAG
GCAAATGTGGGTCACAGCAGGAGGCTCGGAACGCTGCTGTGGCGTGGGATTTTCTGCGTCTGGAGTGCGCGAACTGGCTGCGTCTCCTTCCGCCCTGTTG
ATGGCTCTCTGGCACTGGCCTGTTTTTTTCGGAGTGAGCGCGGGGAAAGACGGCGGCTCTGCCCTGCAATGTGCACAAGCCATGTTGATGAGCTTGTCGA
TGAGGAGCGGGTTGCGAGTCACTCTGAAACTGGCTTCAAGTTCAACCGCTCCGCTTCGCTTTTGATGTGAGACCTTGGTAGCGAGAGGAAGAGTGAGGGC
TTCACGGAGCTTTATGTTGGTGCTGCCAGCAGTACACATGGGCTGCGCGCTGATTAGGCCACTGCTGTGAACCTCGCACGCAACAGCATAATGCCCGACC
ACCACATGGATTCTCCATCCCTCCACATGGCGTCTGCAAACCTGGCATTGCTGTTGCTCTGCTACGTTGTCAGATAGTCCACACCTGCAAACCAACACTC
GAGTACATTCACATGAAACATTTCCATTTCCCCTTGACCTTCCTACTTGAGCCGCTGCGCCGTGGCGGCCAGGAGCTGGCTGGTGAACTCCATGTCGGCA
GTGCGGACCGTCAGGTCCACGAAGCCGCCGCTGCGGATCTTCACGTGGAGCAATCCTACGTGCTCCGAGTTCACGAGACGGCAGGCAGCAATCGCTTCGT
TGGCTGGAGAGTAAGCAAAGTGACAATGTTAGAGCTCGGCCACACAACGCAGAATAAAAGAGTTATGCGACGTACTGGTTGGGATGGCTTCGACGGTGTG
CACGTTGAACTGGTGCATGCGGCCCATGAAATCTTCGAGCGTGCGGATGCCGCTCGGGTTCACCTTGGTCTTCTGCTCGCACGGGCACGCGCCCCAACGG
CCGCCGAAGTCCTGCGTGGTGATCTGCCACGGCTCCAGCTGCCGTCCATTGTACTGGAAAACGCCGGTGCTGCTGCTACTGCCACCCAGAATATCCAAAC
CATTGGCAGGGCTCTTGCCAAGCTCAACGCAGCTTCACATACAAACAAAAGCAAACCAAGCCATTTAGCAACCATCCACCATCCTGATGCATCAGAAACC
TTTCCTAACTTACCATTCATGCTTGAGCCGAGTCCAGACATGTCGAACGGATCCAAAGAAGCAGAGGGGGCCGGCGAGCTCGCCTCGCGGGCCGGTGCTG
GCGCTAGTGGCGAACCCATGCCAAACGGGTCTGCGTTCATAATCGGCTGCTGTGGGGGCGGTTGCTGGAACATGCCTATGTTTTGCGGGGCTGCGGGTGC
GTCAAACGAAATGTCGAGCAGGTCCATTTCGACCTTCGGCTGCTGCGGAGGAGGCGCTTGCTCCACCGGTGCTTGAGGTTGAGGCGGCAGCTGCTGCTCG
TTGCGGTTCGATGAGCGCTTCGACGACGAGCGGACCGGGCGGCGACTGGAGTTGAGGGTTGAACGCGTACTTGATCCCACGCGACGAGCGCCAGGCATCG
GTGCCGGGGCACCAGGAATGCCACCAAAGATCGCGGAAGCCAGGATCTGTCGCTCGTCAACGTTGCCATTAGATTCGTCCTCACTCGTAGGCTCACCGTT
ATCGTAGCTGTTCGGGGCACCGTACTCCTGCTGCGGTGGCTGCTGAGGAGGCTGAGCACCGTAGGCGGCTGACCACCGTATCCACCCTGGCCGCCATACG
CATGTTGGCCGCCGTATGCAGCCTGACCGGGCGCGGCTCCCTGATTATACGGGTCGGAAGGATAACCTCCAGGAGCGCCGGCACCCGGAGCTCCGGGAGC
TCCGGGTGCAGCATTATCGGGCGTATTGAGACCAGTAGGACCCCACACGTTCTTGACCACGCCGCGCTTTCCAGCGCCAAACCCTCCAGTAGGATCAGGG
CCGCCAGAACTACCCAAGCCAGGCATACCACCCTGTCCACCATTACCACCCCACTTGTTGACACCAAAGGCGCCTTGCTGGTCCGCAGGAGGGAGCTTCG
TCGGGTACGGGATCTCGGGCTTCTTGTAGGCCTCAAAATTCAAGCGGTTCGAGTCACCGCCATTGCGACGGTGGCCGTAACCTTCATCCT