Description :
From Genome Similarity Track
Location :
Scaffold_80:30133- 31743
Sequence
1610 bases(100 bases per row)
GGTATTGAAAGTCGAATTTATCCACGGACTCATGCCGGCTTCGCCGACGGCACGTAGTGAGATTGCATAAGCCGTTCCGGCGCCGAGTCCACCAACAGTA
AGTGCTTCGCAGTTGTATGTCGACTCGCCTCGCCGGTCGCAAGCATGTGACCGCTCCAATATGGTCGTTCCCGAACCAGCGGTGGTGACAAGAGCATCGA
TGCTCAAGGACCCGCCTCCGGCCGTCGAAGGTGGCAAAATGACGAGCGTCAATTGACTGGTCGTCGCAAACTTTAATGTCATGTTGGGTGTCGATGCCAC
GCCGTTGGAAGTTGTCAAGTTGACGGTAACCCACTCACTCACACCGACAGCAGTTTCAGCTCGGACTCGGGAGACGTACGTTGTCGCTGGCAGTAAAGAT
CCCAACTGGACTGAGCAGCAAATGAAGTATGCCTGTCTGAGCACGATGCCATCGAGGGTTGCCAGCTCGTAGTAAAACTGCGAACTGCCAGTTGAACTGT
TTCCGCCATCGTCACACGCGGGCTCGACTTGAATGAGCACTGACGATGGACGAATCTCGCTTACGACCACAGCTGGAGACCCCGGTGAAGTTGGACCCGC
TGTGCGGAATGTAGTTCTTGAGCGATTAACCAAACCGGCCCCATTCTCCACTTCCAGCAAGTACATGAAGTTTGTGTTCGCCACCAGACCGCAGTGGACG
AAATCCATTGCCGCTCGAGATTCCAAGAGCACGTTGCCGTTGGCAGTGAGCGACAAGCGTGTGATTGGGGCACCACCGGTATCCTGCCAATGAAGCCCAA
GTGAGTCGACGTGGTTGGATACTTTCAGATTCCAGGGAGGAAAGGGAAACGAACCTTTGGCATTGCCCAAGCGAGACTGATGGAACCTCCAGCACTTGCT
ACTAATTGAATCGTTGGCGCTTCTGGTGCTGTAGCGGAGCTATCCACAACAACAGATATTAGGAACATTTCGGTCAGGCAATACAACGATCACCCTTACC
TCGTGGTGATATACCGTGGTGACGATGCCGTGCTGTTACCGACGCCGTTCTCAGCGACCATCGTCACAATCTGTGATGTGGTTGCATTCAGCCCTCGGAA
CTCACACGATGCCACCGCGCTAGCATTTGTGGAACAGAGTGCTTCAGTCCGGACAGGAATGCCGCATGCCGCGGACCCGCTAAAGCAGCACAAAGCTATT
GTGGGCGGTGAACACGATCTGGGTGCGCACGTTTGGGCCGTATCGACTGGCAAAAACGAGTAGGTGCCACTTTCATTCGCCTGCAGTGTATGCGAGCACT
GGGAACACGAATTCGTGGTCGAGAAACACTGCACGAGCGAGTCAGCAAACGCATGATATCGGATCGCCGACGTTGGTGATCCCCCGAAATCTCTGCTCTC
GTTGAACGTGAGCGCAAGGGAGCCGCCAATAACGTGTGAGATGTTGAGAATCGTTGGAGGTGATGGTACCGTCGCGGCCGTCGTTCTCGCTGTCACAGTG
TAAAGGTCAAGAGACCCACTCAAGTTGTACTGGTTGATAGCGACGACCCTGATTCCGTAGGTTGTGGAAGCAATCAGTCCAGTGATGTTGAATTGTCGAA
TCTGAGGCAT