Description :
From Genome Similarity Track
Location :
Scaffold_65:30131- 31643
Sequence
1512 bases(100 bases per row)
GGGATGGCTCGGCCATTATCAGATCTCCTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGCACGACGGAGCCTTTGATGCTGTGAAGGAGAGCCTTC
TCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCTGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGA
CGCCGAAGGGCGTGAGCGCGTGATCGCGTTTGAGTCTCGCCAGCTTAAAGCTGCAGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATAAGG
TATGCTGTAGTCAAATTCAGGGTACACCTGTTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGCTACGCACTGCGAAACAGTCGCCTCATC
TCTCTCGAGAATTGCAATATGGCTTTCCTTCTTTGCCAAATACAACGTCGAGGTGAATTACAAGCCTGAGCGGCTAATGTAGTGGTCGATGCCACCTCGC
GCTCAGGCCGGACTACGAGTTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTAACTGGATACACAGAGCGTATGCACAGGACGACATGTGCGTAGCG
CTACTACGGGCTCTTGGAAGCGAAGGGTTTGAAGACTCTGACATGGAATTGTCTGGGCGCTTACGCGCGAGGCTGCATCGATACTCGCTCGATTGCGGCC
TACTGTACTACAGCACCGACTCTGAGGATACCGCTTGTGTAGTCGCTCCTCATGATGAGGATCTTACGTATTGAATCCTCTATGAGTTTAATGATATGCC
CGTGGGCGGGCACTTAGGGCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATGTATATGTGGGTCGACACCTATGTACGCACG
TGTAAGACGTGTCAACGGATAAAGTCTGCGCCGAGCACAGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAAGAGATGTTGGCAGTCCATGAGTATGGACT
TTGTGTTTGACCTTCCCAAAGATAAGGCGGGAAACATGGGCATTGTGCTCTTTGTAGACCGATAGAGCAAGGTGGCTCATTTAACGGCGGTGCCGGACAC
CATTGATGGTGAAGGTACAGCTTTGTACAGCTTTTTTGTTTATTGTGTCTTTCGGCAACATGGCTTGTCGGAGGCAATTGTCTCGGATCGAGACCCGCGC
TTCACCGCGAAGTTCTGGATGCCCCTCTTCAGAGTGCTCGACACTCGTTTGGACATGTCCACAGCGGACCATCTGCAGACCGATGGTCAAGCCAAACGCG
TGAATCGCGCTGTGGAGGATATCCTCCGAACCGTATGCGCTGAGGCGCTAAACGCTGGAGCCAGATGCTCCCACTCGTTGAGCACGCGTTAAATAATGCA
GTGCACGCCTCGACAGGCTACACCCTGTTCAATGTGAACGGCTTGGTGAACCCTTGCGTCCCACTGACGCCGCCACGCAGTGTCTCAGGACTTGATGGGG
GAGGGATAGCCG