Description :
From Genome Similarity Track
Location :
Scaffold_19:301288- 311733
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007634Protein of unknown function
Pytul_DAOMBR144PYU1_G007633Similar to bpr: Bacillopeptidase F (Bacillus subtilis)
Pytul_DAOMBR144PYU1_G007632Protein of unknown function
Pytul_DAOMBR144PYU1_G007631Similar to bpr: Bacillopeptidase F (Bacillus subtilis)
Pytul_DAOMBR144PYU1_G007630Similar to Tspan3: Tetraspanin-3 (Mus musculus)

Sequence
10445 bases(100 bases per row)
GAGCGAAACAGCTCTGTTAGATACTCAGGATGTTGGTACAGAGTCGCCATATGGCTCCTGCCGCGTGAAACTCTTGGACGCGACAATCTTCTGGAGTGAG
GCGTTCGGGATCGCATGGAGCGCCACAGGCTTCCTGCTCATCGTACTGCTGTTCTTCGTCGTATTGCTCTTGCGCAAGCACACACATGCAGATGCACTGG
ACCTCGACGACGTTGACAACAACACCGAGGCCGTCTACGAGAAAGCGTAGTACGAGCATGCAGCAAGAGCAGCTTTGCTAACAAGAAAGGTATCGATCAA
AGTCCGTTGGTATTATTATTTACTCATCAGTACAACTATAAGGAAAAGTACTTTGTTCAGTTTTTTCTGTTGACAGCGAACGATTTATGGAGCTGGGCGG
AAGCCCTCGTACGCGTTGAACACGTTCAAGCGGCCGTGGCCGAACTGGTTGTTGGGCCAGGCCTGGTCGGACGTGGCGCCACACGTGTAGTTGGTTGGCG
CCAAGCCCTTCTGGTCCGTCGTGGTGTAGAGCGCGACCTTGACTTCGTCGATCGCGAGGTCTGGTTGAGCGGCCAAGAGCAAAGCGACAGCGCCCGTGAC
GTGAGGAGCAGCCATGCTGGTGCCCGAGATGGTGCGGTAGATGCTGTCCGTGGAGTTCCAAACCGAGCGAATGGTTTGACCTGGCGCCGAGATATCTGGT
TTGCGGCGACTAGTACCCACAGTTGGCCCCTTGCTACTGTAGTCAGAAAGAGCGTCCGTGCTGGTGGTCGAACCGACACCGATGACGTTAGGGTAGTCAC
CTGGCGAACCCGCCGTACGACAGCCATCGCGACCGCTGTTGCCTTGCGAGAAGACTGGCACAATACCAGCCTTCACCCAAGCGTCGACGGCGCCCTTAAA
GTATGGACGGCCTCCAGCACCTCCCCAACTGTTGTTGATGACACGAGGAGCCTTGCTGCAGTCTGGGTTGGCGCCCTTGGTGTCAGTTGGGCACAACATG
AATTGAGCGCACGCGAACAGATCTTCCTCGGCACAACCAACCTTAGGACCCTCCTCAGTTTCGTACCAGCGGCAGCCCTTGCAAGCCAACCACGTGGCCC
CTGGAGCAACACCGACACCGTGCGAGCCAGCAATTGTTCCCATCGTGTGGGAGCCGTGCCCCTGGATATCGTACGGCTCAGCAGACTCGAGTTCTGGGTC
GTACCAGCCGTTCTTGCCAATGAAGTTGCGCTTCAGAGCCTCGTGGGTGAATCGAACACCAGTGTCAATGTTGGCGACAATGACGCCTTGACCGATGTTG
CCGTCGGCCCAGACCTTGTTGGCGCCGATTCGCTGGATGCCCCACTCTTGTCCAACCAACTCGTTGTTTGCGTCGTTGGCTGCTTGGGGCTCTTCGATGT
AAATCATTTCTTGCTCACGAATCGTGCCGACCGAGCTCAGACCAGCAAGCTTGGCGACCAACTCGAACGAAGCTGAGTTGACCGTGATCTGGTTCGAGAT
CCAGAAGTTCTTGAAGCCGCCATGGAGGCCAGAGCTCTCCTGACTCAACACCTTCTCAACTTCGGCCGACGCGACCTTGCTTTGCGCCTGGAGCTTGTCC
TTGATAGCTTCGATCTTGGCCGTGCGCGACGAGAAGGCGGCTTCCTGGATGCTCTCCAGAGTGGACTCAGTGGTCTGAGCGAGCTCAATGACCAAGTCGA
CTGTGCCGTCCTTGCGAAGGGCACGGTGGACACCCGGGTGCACGGTTGGGAGTGCCGAGGCGGTGCTGGCAGCGACGGCGACGGCGACGGCGGCGAGGAA
AGTAGCGAAGCGGACGTTCATCTTGGTGTTGGGTCACTTGCGCACTGGAGGGCAAAATGAATTACGAATGAAAAGTAGACGCAAAGCGATGATCAGGAGT
CCGACTTTTAGAACGAAGGAGCCGAAATCGAGCTGGGCTGGACTCGTATAGTAGTTCGCAGCTATGAGCACTTTGGTGCGCAAACAGGTAGACTAACGCT
GCACATGAATCCAAGGATACCGAAGAGAAAGGACAAGTGAGGCTCTTCCTCGTACCCAGAATGTCTTGTCCCCCGTCGGCTTTCCTGGTTAGAAGATATC
CCCTCACTGCAAATCGTGATTGATGGGAAGAGTGCGAATGCTTGAACTGAACTGTGTAGAGAGTTCGAATTGGAGAAATGACAAAGGAGGGACACTCTGC
AAGACATGTGACAAAGGTGGGGCAATTTTGAATATTTCTGCTAAAGGTGGGGAACGCCAACAAGGCAGGTAATATAACCGTTATATTACAGTTAAATCAA
AAGTCGTCATTAGTACAAACTGTCAGAATTTATTTTGTCACATTTGTATCAATCCGAACAAAATATATTTTTTAGAGGTGAAATACCAGATAGCACTGGG
TGGAGCTGTATGAGCTTGACGCTGGTGTAGCTTAGTGGTAAAGTCCTCGTTTCACACGCGAGACGCCAGTGGTTCGATTCCACCCATCAGCATAATTCCA
ACCTTGGTGCTTTGCATCTGGGAGTCAATGGTTTGATCAGTAAGCCCGGCATAGAAAAGCTAACGCGACCGCCCGGGCCCAAAGTTGAGCAGGTTAACCG
CCAGTATGCTAAGAACCATGAGTCGGGTGCCTCTTCTGAGAAGGATTCAATACCGGATGGTGTCTCAAACTCAAAATCACAGTGGCCCCAGGCATACAGA
GGGATATCGTATCAACAAAAATGAGAACAAATTTTTTGTAAGCGTCCCACCTGTTCCTGCTTTTCTTTCTTGTCCACGCGGACACCGTACCTTTTTTATG
CGCACAAGTGTCTTGGTTTTTGCCAATCATCTGTAGAAACTATGACAACCCACCAATCACAGAAGAGTGATCTGCAATCCTTCTCTTGTGCATATCGATG
TATTCATAGAAAAATGAGACTGTGAGGGCTTTAAATGTATCCATCTATTCAGGGATACGGATACGCTGTGATCATATCTTTTAACGTCTTACGATGTTGC
ATATCAGCCATCTACCCTTGACTGTCTACCATTAGCAAATTTGCCATGTCCAAGTTAAGTGTTGGTGATATATTTCGCACACGCACTGAAGCTGTAAATG
CCATTCAAGCTGTTGCGCTGTCCTAGAATCGCCGGACTATTGTCGACAAGAAACGAAGTGGGGGTAGCCAGTTCATCTACATTTGCAACAGCTCTACTCC
CTGCACCTTTGAAACCGTTCTCGCCAAGTCCCGACGCAAGGTTTCCAACCACATAGTCGTAAAGTCGCTGAGCTTGACTCATGACAACTGTACGGGGATT
GCGAAAGCACGCAGAAAGGACATGACAAGCAAACTGGTTGCGCAAAATGCTGTAAATGCAAACATGCGCATCTCTGGCGCATCATTGTAGTATCAAGTAA
AGGCTGATGCGGGGATTGGCTTAAACAAATGCACGGCATATCGGGTGATCGATGATCTTGCCCAGTTGAAGTATGGTAATTTTGAGGCGGGGTATAAGAA
GGTGGCGCTGTTTCTTGAAGAGTTTGCGACCAAGAACCCAACATCATTTACAGCGTTTGAAGCACGTGATGGCAAATTTCATCGCACGTTCCTGATGAAC
CCACACAGTAGAAGAATCCAGCCCAACTGTCAACAGATTCTCGGGACTGATGGCGCGTATACCAAGCACAAACTACATGAAGGAAAGATGCTGATCCTGA
TTGCGCGAGATGGCGACAGCAAAATGTGGTACTTGCTGCTGCATCGTGTCCATCTGAAGACCGTGACAATTACAACTGGTTCATCGAGTGTTGCAAAAAC
GGTGGCATTGTTTTTGACAATGTACCACTGTTCTGTGACAGAGGTGTTGCCCTCGTCAATGCAGCTACCAGTCACAATGATTTGGCGCTGATACATTGTG
TGAGACATATCATTGGTAATGTGAAGAAACAATACAAGAAAACGTTCACGACGCTCATTGAAGGCATGATCTATAACCTCCAAGGAGCGGTCAGTGAGAG
TGCCTACAACAGCGAATTGGGGATCCTGAAGTCGTATAATGAAGATGCGCATGGATACGTCGCTGCCATTGAACCCTCAACTTGGTACCTTTATCCCAGC
ATTGGGATCCGTTCACTCTATGGATGGCGAACCACGAATTTTGTTGAGTCGGAGAACAGCTCAGCTCTCAAAGCTCGACTCTTGCCTCCACTGCAATTTT
TGATGACGTACGTGGACAAGATGATCATCAAACGCTACGAACGGCACAAGAAATGCAAGAAATGGATTGAAGATGACAATATCTTGACCCCATATGCTAA
AGTATGTCGTGATATTGAAAGGGAAAACATGACTTTCTACACGGTTCAGCCTGCGACGTCATTCGAAGCGTATGTATGGCGCTGTTAGCACTATCCAATA
TACAAGCACATAGTCGATTTGGACACCAATACCTGCACGTGCATGTACTGTGATCAGTATTGCATGCCATGCCGTCACATAATGGCTTTTCTATCGCGCT
TCAACCGCTTAGATAAAGTTTTCGATTATTATGAAGACTGCTATAAGGTTGCCAATTATGCTCAACTTTACAGCAAAGACAACTCGATTAGAAATCCCAT
TGACCAAGAGCTGGAGTCAGACAACATTCTCCCCCCACCTCGCATTGCTACACTTGGTAGAGCAAAGATACAAAGAATTCCAAGTCAAGGCGAAAGAGTT
TCCTCACGCAAAGCCACGTGCACAATTTGCAAACGGCACGGCCATAACAAGCGGTCATGCCCGCATCGGGAGAATTAAAACCGCAGCTAATTTTATATTT
TGTATTTTACAGCAAATCATTTCATATTTAATAAATATACGAAATATTCGGTTTATTAGCAAAATGATGTAATATAACGATTATATTACCTGCCTTGTTG
GCGTTCCCCACCTTTAGCAGAAATATTCAAAATTGCCCCACCTTTGTCACATGTCTTGCAGAGTGTCCCTCCTTTGTCATTTCCCCAGTTCGAATTGGTA
TACTGTAGTACTAATTTTGTTTAATACGATTCAATTAATACGGCTCAACGATTACAGCATTGCGCTCTGTCAGCCCAGCGACACTTCCATCTCCTGACAC
TTCAGCTCCAAGGTTCAATCTGCTGCAGTTTATTATAGCAATTGCGGCCCAAGCGAAAACTTCAACTGCTGCTACGGACAGCATTGGCATTCAGAGGCAA
AGTCTCACTCAGTTGAAGGCTCGAATGAGGTACTGAGGTGCAATTGATGTCAGGAAGCATTTGCAAAACGTGGAATTAGCCTCATCCAAATGAGCATTTT
AGCGCGCAGCAAGTTCGAGTGTGACGTCATGGGGGCGCACAGACACCATAATACAGTACATCAACATCCGTTACTCCTTATGTCCGCTATTTGCCTGTTG
AAAAAAACCTGAAAAAGCTTTGGTGCATTTCTTAAACCCGCAAAAACTAAAATCTGCAATGCGGATGTATGCATAAAAGGTCCGAAATCATATGGTTGCA
GACGATGTTGACGGCATCTGATTAACGCCCTGTCTATGTGCCAGCCGTGATGGTGAAGTACTGACACATGAGGGTGGGATATTCGCTATTTGTTTGAAAA
GAGGAACACACAACACAAGAGTCGGATGTGAGGTTTGAATGTGGTTGACTCGACAACCTCCTCTGCTTGCCTGTACGAATCAAATGTGTACGAATCAAAC
TCACTGAGCATAACTAATGGTGCCCTGCCGCGAGTGCTCCTCGCATTTCACGATGCCACTCGAAGCTCTCTGTGCGGCTACTTCTAGGACTCCAGCACAA
AAGCTTTTCCATATCCATCGCGAGTCGCTGTGTTTCGCGTCACAGAATGCCAGGTTTGGAGTTGGGCACAACAATTGAAATCCATCGCATCATGCAATTG
TATGGATACTGGGATGCCAAATCTGAAACACTGGAATGCGCTACACGAAGTGAGTGAAAGCTGACAAAGCTGACAAGCTTGCAACTCAATGGTGTCGACA
TCTATGATCAGATTTTAGTATGCAACTGGTTTCACTTTTACAGTTCAATGTCCAAAAAACGCATCCTCGTTTGCGCAACTCAAATCCCGCGCTCGCTGCC
TTATTCGTTTTTGCTTGTGAGACCTCGCTTGTTTTGGATTTGCAGATGGCATAGTGTCGTGGTCAACATCTTCAAAGTCCAGCGCCTCATTTCCCTCATT
GTGCAGCGCAGAATCCAAAGCACACTTTATCTAACCTGTGCTACTCTTCTTGTAGCGAGCCCTGCTGCTGGGGCGAACGCGACCACGGACTAGCTGCGCA
AGAGAAATGGCTATTGTAACCGAATAGATCATCCTCCTGATATGTGGCTCTTCTGACATCCATTATTCGTGTGCGGAGAGGGATGATAACGAGGAGTTTC
GTAGGGAGGGCCAAAACGCACGATGCTAAAGTCGCGAAGCACCGGAGCATAAAGAGTGCGGGGTGCCCCAGAGAAACCCTCGAGCGAACCCAGTAAGCAT
ATACAGACCCAGATCATTCAATCTATTGTATCCCACAAGGGGGACAAGCACAGTGCTAGCGCTGTGCGCAGTGGGGTAAAATACACTCGCGACCGACCGA
TCGTAGCGAGAGGAACACCCTTTATTTGACTCTATGAAGATGCTTCGGGGATACTCCACTTGATTGTGCCACTTTTCAGTCTGTTGTATTCGGTCGCAAT
AACTCGTCCGACGTATCTAGGAGAATGCTCCATTCGGTCACAATAGCACGTGCCACTGCGTAAACACCAGCCTTCGTGTATACTTCGTGTAGATTGCCAC
GACTCATCATGTCGGTGCACAGAAAAATGCAGGTTCTTACACGTTTGTCTATCTACTCGGGTAGTGTCAAGTACGCAATATAGAATTTGACTTTATTAAC
GTAAAAACAATTTTTTACAATGCATACTGTATTAAATCCTTATACACATCATATCCGCACTGCGGATATGTTCGAATGTGGTCTTGTTTTTGTGATGATA
GTTTCTATGATTTGAAATCATATGGTTGGAGACGAAGTTTCATTATCTGATTAATGCCCCGTTTCTGTTTATGATGTACCAAACTGTAGTATTAATAACC
AGCACTCTTGCATGTCAAAGCCATCAGCAAGCACTGGAAGGTGAACAGATGCTTACAACTCCAGACTCACAGAAAGCTCGAGTCTGTTGGTCTTAGAGTT
TGAACCTGGGTTGTATTGAACTTGAGCCATTTGCTTCGTACATGCCCAGATTTAAACTGGGTCCCCTTGAGTGTCTTCTGTCAGCCTTTTTCTTATAAGA
CCCTTTGCTTCAGGGACTCTGACAGCAAGCAGCATTCAGGTCGTCTGTCCGCTGGATTAGAATTCAGAAGCCTAAGAAAGTAGGTCGGAGTGCCACGTTT
GCGACACAAAAGATTGGGGGAAAACGATGCATTGGTGTATCTTAGATTAGAAGATGGTGAACTAACGGATACCACTCGGTGACATCAGATTGAGAACGAA
GGGATCCTGGTTTCTGTGTGGGAAAGGACGCGCACGTTGTCCTTCGTGTGCAAAGCCACTTCTCTGAGCGGTGAAATCCGCCATCTGTTCCCGCCACGAG
GTCGTGACCGCATGCCTTGTTTGCATTCCTCCTCGCGTTCTTTGTTCTCACAATTCATTTTGCCCTCCAGTGCGCAAGTGACCCAACACCAAGATGAACG
TCCGCTTCGCTACTTTCCTCGCCGCCGTCGCCGTCGCCGTCGCTGCCAGCACCGCCTCGGCACTCCCAACCGTGCACCCGGGTGTCCACCGTGCCCTTCG
CAAGGACGGCACAGTCGACTTGGTCATTGAGCTCGCTCAGACCACTGAGTCCACTCTGGAGAGCATCCAGGAAGCCGCCTTCTCGTCGCGCACGGCCAAG
ATCGAAGCTATCAAGGACAAGCTCCAGGCGCAAAGCAAGGTCGCGTCGGCCGAAGTTGAGAAGGTGTTGAGTCAGGAGAGCTCTGGCCTCCATGGCGGCT
TCAAGAACTTCTGGATCTCGAACCAGATCACGGTCAACTCAGCTTCGTTCGAGTTGGTCGCCAAGCTTGCTGGTCTGAGCTCGGTCGGCACGATTCGTGA
GCAAGAAATGATTTACATCGAAGAGCCCCAAGCAGCCAACGACGCAAACAACGAGTTGGTTGGACAAGAGTGGGGCATCCAGCGAATCGGCGCCAACAAG
GTCTGGGCCGACGGCAACATCGGTCAAGGCGTCATTGTCGCCAACATTGACACTGGTGTTCGATTCACCCACGAGGCTCTGAAGCGCAACTTCATTGGCA
AGAACGGCTGGTACGACCCAGAACTCGAGTCTGCTGAGCCGTACGATATCCAGGGGCACGGCTCCCACACGATGGGAACAATTGCTGGCTCGCACGGTGT
CGGTGTTGCTCCAGGGGCCACGTGGTTGGCTTGCAAGGGCTGCCGCTGGTACGAAACTGAGGAGGGTCCTAAGGTTGGTTGTGCCGAGGAAGATCTGTTC
GCGTGCGCTCAATTCATGTTGTGCCCAACTGACACCAAGGGCGCCAACCCAGACTGCAGCAAGGCTCCTCGTGTCATCAACAACAGTTGGGGAGGTGCTG
GAGGCCGTCCATACTTTAAGGGCGCCGTCGACGCTTGGGTGAAGGCTGGTATTGTGCCAGTCTTCTCGCAAGGCAACAGCGGTCGCGATGGCTGTCGTAC
GGCGGGTTCGCCAGGTGACTACCCTAACGTCATCGGTGTCGGTTCGACCACCAGCACGGACGCTCTTTCTGACTACAGTAGCAAGGGGCCAACTGTGGGT
ACTAGTCGCCGCAAACCAGATATCTCGGCGCCAGGTCAAACCATTCGCTCGGTTTGGAACTCCACGGACAGCATCTACCGCACCATCTCGGGCACCAGCA
TGGCTGCTCCTCACGTCACGGGCGCTGTCGCTTTGCTCTTGGCCGCTCAACCAGACCTCGCGATCGACGAAGTCAAGGTCGCGCTCTACACCACGACGGA
CCAGAAGGGCTTGGCGCCAACCAACTACACGTGTGGCGCCACGTCCGACCAGGCCTGGCCCAACAACCAGTTCGGCCACGGCCGCTTGAACGTGTTCAAC
GCGTACGAGGGCTTCCGCCCAGCTCCATAAGCGCCGATGCCGATACTTTGGCTTCGACAAACTCATAGTGGCTACCACAGTCAGCTGTGTATAATGTATT
AACACAAACGTCTTTGTCAATAACGTGTTTTTTTTCTCGCTTCCATTGATAATTTTCGCGTGGGTTTAATGCACTGAGAGCCCCCTGGGTATAATAGATA
TTGTACAGGATCTGGGTTCACCACGACGCATTAGTTCTGTTTGTTTACTTGTAAATGGGTGGGCGCGAAAACGTCGCTGTGGGCGTGTACAAATCGTGCT
CCCCCTGGTTGTGGTGGTACTCGTTGGACGAGCTGTGGCCGCGGCCGCGACGGCGTCTCAAGTAGCACGAGAACACGATCACGCAGAGCGCGCCGACGCA
CACAAAGATGCTCCCGAGGCCCATATACAACGCCGTGCGTTTGGCGAGATCGAGAAACTCGTCGCGGCACTGCGTGTATGGTGCGGTACCGACCGTGATG
TCTGAGGCCGAGCCCGTGGCGAGCAGAGTGCCGCACCACAGCAGCGTGTCTTGTGTGCGCGGGCATTGGTCGTTCGCCCAGTCGAAGACCGAGCTCAGGT
TCTTGAACTCGCTCGCGACGGCGCATCCGTCGCACACAGACTTCAGCTCCGAGATGCTGCTCAGGTACGTGTCACAGAGCGTGCCGATGCCCTGGACGTT
GCCGAGACTCTGCAGCAGCGACGCGTTCAGACTCGGCGCGAACATCGCGATCGCGTCCGAGATCGTCATCGAGTTGCAAATGTACTCGCCCTGCGCCGCG
CAGTAGATCTGGTCAAACTCGCCCTTCACCGACACCTCGTCGTTGTTCGCAGGGTACGTCTTGTCCTCCCAGTCCGCAGCCTTGCCTCTCAAGATGAACG
CCGCGATAGTCACAGCCGCGAACACGAGCAGCAGCAGGAACACGAGCCACGAGTAGACGAGCAGTCCGAGACGCCAGCGGCAGAGCGCGGCGATGGAGCC
GAGCACAGCCAGCGAGATGACCGTGATGCCCACGGCCTCGACGACCGTCAGGATTGTCCCCGTCGACGAGTAGTACGAGCGCACGATGTCCATCCACGCC
GTCGTGCGCACCCTGAGCGCCACGTAGAGAACAAGCACGCCGCCCGCCAGCAGCACGCAGTTGATCGCGACGAGAATCAGCGCGCTCATCCAGCGCGCGC
AGCAGCCCATGCTTGTTGAGAGAGAGAGAGAGTCCTGGTTGATGCGATCGCTTCGGCGCGAATTCTCAAATAATGAGCAGGTTGCCTTTGATGGACGGAT
TCTCGCGTAGTCCTCAGAAAGAAAACCATCTGTGATCTAGAACGG