Description :
From Genome Similarity Track
Location :
Scaffold_157:30128- 33092
Transcript NameFunction/comments
Phyag_g2850multidrug resistance protein ABC superfamily

Sequence
2964 bases(100 bases per row)
TGGGTCATGAACGCCATCGGTCTTTGGTACGGCGGAAAGAAGGTGTACGAGAGTGAAACAGAGCCGAGTAAAGTGGTCGAGACGCTCCTCGGCGTGATCA
TTGGAAGTCACGCACTTGGTCACTTGATCCCGAGTTTTTCAGCCGTGATGCAATCAAAGACCGCCGCCTCCAAGCTCTTTTGCTTGCTCGAGACACCTTT
AAACACCAAAACCCGCAGCCACGACGGAGTCATGAACCCGTTGCCACGACCAGCTACATGTTCTGGTGCAGTGATGGCTGTCGATCTGCATTTTGCGTAT
CCATCCCGACCCCAACGCCACATCTTGAGAGGTTGTAATATATCGATCATGGCTGGAGAATGCGTCGTTGTCGTGGGTGGAAGTGGCTCGGGAaagtcga
cgctggtgaTGCTGTTATCGAGATTGTACGAGCCTTCACAAGGTATCATGTTGCTCGATGGCCGTGAGATGAGTACGCTGGACCCGACCTGGATGCGAGC
TCAACTTGGTGTTGTGCCACAGAACGCGACACTGTTCCGAGCCTCTATCTTCGACAACATCACCATGGGTCTGGTCGTGCTACGAGACTTGAGCGGCCGC
AATACCGGACAAATGGAGGAGCGGGTGATCAACGCAGCGCAACGCGCCGACGTCCATGACTTCATTGTGTCGCTGCCCGATGGGTACAACACACGCGTCG
GGGAGAACGGGGATGTGAACttgacgacgcagcagcggcaacgaaTAGCGTTGGCTAGAGCTCTCATTCGTGAgccgaagttgctgctgttggacgaGGT
CGCTATCAGTCCCCAAGAACTCCTGTCCAGGTtcggtggagctgttggcgctggaagtACAACAATGTTGCTGAGCACGAGTCACGTGAGCGCTGCGGCA
GTGCAGTACGCCGACAAAATCGTGGTTATGGAGTCTGGCAAAGTCGTAGAGCAGGGGACGCACGTGGAACTTTTGCAGCGTGGCAACAGTTTCtatcgtc
gtctccacctcatCGAGCACAGCATTGCACGGGAACAGCATCCTACTGGAGAACTGCTGACACCTTGCCAGAGATGCCAATCACGGGTGGCTAAGGCGGC
GCCTACGTCGCCGACGAAACTCACGAAGCGAAACATTATAGCTCTCGCTCGTCCGGAACGCAAATTCTTGGCAAGTGGACTAGCTGCTTCGGTCATTGTT
GGACTTGGTGGACCGCTGCTCGGCGCGTTGATCAGCGAGATGCTGGCGGACTTGACTCAGCAATACGTCATTTTTCTCGAGTctcaagatgcagcgagtC
TGGTTGAGACCCTTCGCCCCCGTATCATGAGGTACGGTTTCTTCTTaagtgctggtgctgcagtcaTTGTCGTCTTCCAGAGCATTCAGCTTTTCTGCTT
GGACGCAGCGGCTGAGCGTGTGGCTTCGCACCTCCGGGATGTTCACTTCAGCTCACTTCTGGCCCAACCTTTGCCGTTCTTCGACGCTCCGCAGCGCAAT
TCCAAAACTCTGACGGACTCACTGGCTACACAggcttcgactgcagcgctggcagtTGGTCGAGACCAAGGATACAAGCTCCAGACCCTCACCACCTTAG
TGGCGACGATTGCTGTAGCTTTTTGGCGAGGAAGCTGGATGCTCACGCTTGTTCTGCTAGCAACACTCCCGCTGCTCCTGATCGGTGAAGGCATTCGCAA
CCTAAAAACTGTCAACACCCCAGCATCGAACTATGGAGCCGCGTCTGAGGAAGCTGTGGAAATCCACGTGAGTGAAGCACTGCGCAATCGTCGagcggtg
gtgatgctgggTCTCGAGAATTCGTGGTGTACCAGCTTTGACTTGCTACTACAACGTCCCCTGCGAGACATCAGGCGTAAAGCGCAACTTGAGGCGGTGG
GGCGTGGCTTCAGTGCagttgtggtggtggccacctGCGCTCTGTCATGTTGGTTGGGTGGGGTCCTTGAGCACTACGGAGACGCCAAATTCCGCGAGTT
GGTACAATCTCTGGTGGTCGTCGTAGTGTCGGCTCAGTCTTTGGGGCTTGCTGTGGCTTGGTTGGGCAGAATCGACGGCGCGCTACAAGCTAGTGCCAAC
ATATTCGCTTTGCGCGACGCAGCAATCGTTGGTATCAGCACCAACGGATCGACAGCCCCTCCGTCGCGTGACTCATCAGACGGAGAACATGGCCCGATGC
CGCAGAGTCCTATGATCAGAGGTGGTATCACTCTGCAAGACGTTCGCTTCGCATATTCAACACGTTCAAATGCTCCGGTGCTCAAGGGGCTGACTCTGCA
TGTTGCAGCTGGACAAACAGTGGCGTTGTGTGGTCCAAGAAGATCTGGAATCTCCACGGTATTTGCGCTCCTTGAAGGCTTTTACGACTTGTACTCCGCT
CCAGTAAACAGCGGCCGCGTGATGTTGGACGGCGTGGATATTCGATCACTGGATGTGGCGTGGCTGCGCACTCAGATCAGCTTTGTTGGACCGGAACCCA
CGCTGTTCCTTGGCACAATTGCTGAGAATATTGCGTATGGAAtggcagctccaccgacgctggagatgatcgtcgctgctgcggaggtgGCTCATGCCCA
CACATTCATTTCACGACTTCCGGATGGCTACACCACACGCGTGGGTGGAGAGCATCAACTCACACCAGGTCAGCGACAACGCGTCGCACTTGCGCGTACT
GTTCTTCAGGATGCGAGACTTCTGCTGTTGGACGAACCCATCCGAGATCTGGGAGCTGAAAGCGAGAAGATCACGGTTCAACAGGCTTTGGACACCATTG
TTGCGCAGCGGGTACGTCGAACGACTGTGATTGCAGCGCATCCATCCGAATCTGCTACAGTGAGGAACGCCGACACCATCTACGTCTTGGAGGATGGCCA
AGTTGTTGATCAAGGCACCCACTCCGAGTTGTTCCAGATCCGCGATGGCGTTTATGCCAGGCTT