Description :
From Genome Similarity Track
Location :
Scaffold_229:30120- 32879
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_229-snap-gene-0.18ATP binding domain 4

Sequence
2759 bases(100 bases per row)
ATGAAGGTGGTCGCGCTCGTGAGCGGCGGCAAGGACTCGTGCTACGCCATGATGGAGTGCGTGCGCTACGGCCACGACATCGCCTGTCTCGCGCATCTGC
ACCCGCCGCTTGAGCTGGCGCCCGAGGACGCCGAGATCGACTCGTTCATGTACCAGTCTGTGGGTCACAACGTCGTGGCACTCATCGCCGAGAGCATGGA
GCTGCCGCTCGTGACGCAGACCATCACGGGCACGGCCATCAAGCAGGACATTGACTACCATGTCACGACCGATGGCGACGAAGTAGAAGATCTCTACGGC
TTGCTCGAGAAAGTGCTGGTCAGTAGCAGGTGGAGTAAGTGATGAAAGGTCAAGCGACAGACGCTCTTGCTAACCGTTCGATATCATGTAGGCCGATTAT
CCTGAGGTGGAAGCCGTTTGCACGGGTGCAATCTTCTCGTCGTATCAACGAAACCGCGTGGAAAATGTGTGAGTGCAAGGCGATACAATGAACTAATTGT
GCTCTTGTGCACGCTGTGGGGCTAAAGTATTGATACGTGTATATACCTTTAGCTGCTCGCGACTTGGTCTGACATCGCTGGGGTACCTGTGGCGACGTGA
GCAGGAGGATCTGTTGGACGACATGATTGAATCCGGGATCGAGGCGATTCTCGTGAAAGTCGCGTCCATCGGACTCACGCCTCGCAAGCACCTCGGCAAG
ACCATCGAGGAGCTCCAACAGGATTTCCTGGCACTGGTTCGTTTCAAACATGGGATATATCGTGGTGGCGATAGCCTCACACTGTGTTTGAACCCCAGCT
GATGATTTAATCCTGTTTACTCATGTTATGCAGCAAAAAAAGTACCAGCTGAACGTATGCGGTGAAGGTGGGGAGTACGAGACGCTCACTTTGGATTGTC
CATTGTTCAAAAAGAGAATTGTCATGTACGTGGGCAAAAAACGAGGCTCTACTTGTTTATTTGTCAAGCAGAGAACTGACGTATATCTATGTGTTAAATG
TGTGTTTCATAGTGACTCGTCTCGCGTCGTGCTGCATTCTGACGACTACTTTGCGCCCGTGGCGTTTCTCGTGATCGAAAAGTGCCACCTCGAAGACAAG
GAGCCCGCGAGTCCTTCGAAGCTTGCACCACGACTCCCGATCTCCTCTTTTGTACCAGATTTGACACTCAGCGCTCAGAAAAAGCTGCAAAAATCTGGTA
CAACTAGCGCTATAGCGCTTGCTCAGACGACTCCAGCGGATTGTGCACTCCTTCCAGCGCACCATCAATTCCGCAATCTCTTCCACTTGAGCGGATTCAT
GTGCTCTAACAGCGCATCCCTCACGCTTGAGCAGGAAATCAAAGAGATCTTTGACCATGCCAAAGGTAAGATGACTGGCGAATTCTGCTAATGCGTAGGG
AGGCCCTATGTTCTATGTAAGCCTTTTGATGCTGGACTCATTCTATTCATTCTATTTTGTGCCGCACAGACACACTGGCTAAGGAATCCATGACGCTGGA
AGACGTCTGCTTTGTGCATCTTTACGTCCAAGACATGAACCAGTTTGGCCAAATTAACGCCGAGTACTGTAAGTACTTTGGTGCGCACATGCCGCCATCG
CGCAGTTGTGTCGAAGTCGGGTCGCTGCCAGCTCGCGTGCTCATGGATTGCATCGGGATCCGCGGCAGTGGCGAAAGCAAATTGCGTCAATCGTCACGTG
TGACGCGCGATGTGCTGCACATCAAAAGCATATCGACATGGGCGCCAAACTGCATTGGGCCGTACAGCCAAGCAAACATTTTGCACAAGTCGCTCATCCT
CTTGGCAGGCCAAGTCTCGTTTCTGCCGCAGACGATGGAGATCGTTGGCGCCGACCATTTCGCTCAGGCCAAGCAGTGCTATCGCAACGCAGGAAAGGTG
CTTGAATCGCTCGAGTCCAACTTGCGCCACATCTGCTCGGCGGTTGTGTACACGACTGCCATGGATGCTATTGGATCGACTGTCACTGACCTGACGCAGG
TCTGTCGCGCGCAAATGGTATCGAATGCTGGATTGAAGGACCGATTCGAAGACATTGTCGACAGCGATGAGAGCGACGACGAGGTCGACAAGGACCAAGA
ACGCGTTGCGTTAGTCACTAAGGCGCCGTTGCTGGTGATCCAGGTCTCCCACTTGCCTCGTCACGCTCTCGTCGAAGTGGAGCTGCAAGCGTTCTGCCAT
CGCGTGCTCAAGCACCTGAGTCCAGTCAGCTCGGCGTTCAATCTCAATAACCAAAGCGAGAGCAGTGAATGGGAGTTCGAATGCCAAACGAGCATCATCC
CGCGTGCAATGAGTCTGATCGTGTGCACGGCCACGCTGTCATCGCCTTCAAAGCAAGTCCTTGATGCAGATCACGTGTACCAGAGCGCACTCGGTCTCGT
CAAGTGCATTGAGAAAAGCCTGACGAACGCGCAGCTCCCATGGGACCGCGTGCTGCATTTTCGCGTCTTTTACCAAACGGCTGCGTTCCAAAGTGAAGTT
GGCATCGCCTCAGGTACGTTTATCTCCACACCTCTGCTTGTGTATTTCACGTTGTCTTATTATGGTTTGTGTGTTTGTAGCTTTTCGTGATGCGATCGCA
GCGATGTATCAGCATCCATCGGCTACGGACAGAGCGTTGCCTGCGATGACGTTTGTTCCAACCGAGACGATCCAAAGTGACGCGCTGCTTGCAGTTAAAG
TGACGGCGCACGATTTAGATAAATTAGAGACGGAATTATGGCTCCGCAAGCAAATCTAA