Description :
From Genome Similarity Track
Location :
scaffold_904:3012- 5853
Transcript NameFunction/comments
g10579.t1 vacuolar protein sorting-associated protein 35, putative

Sequence
2841 bases(100 bases per row)
TTCGTGCTGGACGAGCAGGGCGAAGAAGATCTGCTGCGTGAAGCACTGCAGACCGTGCGTGACCAGGGCTTCCGCATGCAACGCGCAGCTGATGCCGGCG
ACCAGCCAGCCGTGCTCAAACACGCAGCTGAAGTGCTGCGCGAGCTGCGCACAAGTCTCCTGTCCCCGAAGAACTACTACCAGCTCTGTACGTCGTGGCG
TTATGCTGTAATATCCCTAACATACTAACAATTGGTGCTATGCTGCAGACATGCAGGTAATGGACGAGCTGCGGCACTTTGAGAGCTACGTGGAAGAGCA
ACAGCAGGCGGGGGCCTCCATGCGGGTGCTCTACGAACGCGTCCAGAGCAGTGGTAACGTGCTGCCGAGACTGTACGGCTGGATGAATTGCTCTAAAGTA
GTGGGACTAGTGACTTATAAGTGTTTTTGTGATGCAGCTACTTGCTGGTGACGGTGGGCTCCGTGTACATCAAGTCGCAAGAAGCTCCGGCTCGGGACGT
GCTGACAGATCTAGTGGAGATGACGAAAGGAGTACAATACCCGCTACGAGGGCTCTTTTTAAGGCATTATTTATCGCTCAGTGTCCGCGATAAGCTGCCA
GACACGGGCTCTGTGTACGAGCAATCCGGTGGAGGCACAGTCAGTGACGCTATTAATTTTCTGCTGCAAAATCTAAGAGAGACCAACCAGCTTTGGGTCC
GTCTGCAGCATCAGAAGATCGGTACGTCCAGACCTCTGGCTGTCCGAGAAAAGGAGCGAATGGAGCTGCGACTGCTGGTCGGAACAAGCCTTGTGCGGCT
CAGTCAGATGGAGGGAGTCACGAGCAGCGTCTACGCTGAGCAGGTATTGCCTCGGCTACTGGATGACGTTGTGCTTGCCTGCAAGGACTCCATGGCGCAG
CAGTACTTGATGGACTGCATCATCCAGGTTTTCCCCGATGAATTTCACTTGCAAAATCTCAAGAAGTTGCTGGACGCACTGGAGAAGCTGCAGCCCCATG
TTGACGTGGCTGTTATATTGACGGCACTTCTTGAACGCCTCACTAAATTTCGGGAGGCTCAGGGGACCCTCTTCAATGTAGACCAGCAAGAGGCTGGAGC
GGACGAGCAGACCAAGCTTGAACTGGAGCAACAAGAGGGACTTAAGGTGTTCCAGGAGTTGATGGCTACGACCTCGAAGTTGCTACTGCAATCGTCACGA
TATGTTGTTGGAAGTGGAGAGCCCCCCAGCGATGGAGACAGTGGGGAGACACACTTAGCCTCTGTCTTGCCATTTTTCGTGACGTTCGCTACTTTCACTC
TCGCGTGGTTGGGTAAAAGCTCCAAGAACAGGAACTTGGACACAACAGCAGCGCTACAACAGGTAGTTTCCGGGTGCTTAACGTTTTTGGGCGAACAAAC
AGCCTGGCGCGTTGACAAAGACAAACAGAAGCGGCAACTGGTGGTTTCACAGCTCGAATCTCTCGCGCTCACGCTTCTACGAGCGCTTTCGATTCGAGAT
CTCATGCAAGTGCCGGTGCTGCGTGAACTGCTTGCTCTGATGCCGTGGCAAGGCGCGTGGAAAGATGTGGCACTGGCATGGATCCGTGTTCTCCTTGCTA
GACACGAGCGTGTCCACACTGAACAGCAAATGGACTTCTTATTGCAGATACTGGCGCCATTGGTGCGTGACGACCCCAACGAGTTGCAGTTGCCACTTCC
AGCAACAACAACGGAATCAGGAACAGGCAAGGAGGCAGAGGTTTTCGAAGCGGAGCAGCAAACGCTGGCCAAGGTCGTCCACCTGGTAACGAACGACGAT
CTCGACGTCAAGTTTCGTGTGTTTTCTGTAGCAAGACGTGCATTCCTGCAGAGCGGCGTCTTCCGTGTTCGTTTCACACTTGTGCCGTTGATTTACCAGT
CGCTGACTCTCGCAAGAGATCTCGCAGCGCATTCCAAGGAGAAAACACAGACTCAAGGACAAGAGACGAAGGCTGAAGCAGAGTCTGCAGCGTCTACTGG
GAATGCCAAGTCGTTTGCCACAACGCCTCGTGAAGTCCTTCAATTCGTCCACGAAATGGTGACGGCTTTGGCTTCCAAACAGGATGCGCTCTCAGTGTCG
TGCGTTTACTTATTTCTGCAGTGTGCGCTGGTAGCTGATGGCTGTGCTTTTGAGGCTGTCGCCTATGAGTTCATCACACAGGCCTTCATCGTGTACGAGG
ACCAGATCACGCTTGCTCGGGAACAATGGCGAGCCTTGGAGCTAATGGTGGCATCGCTTCGTGCCACTAGCAATCTCTCAAGCTCCAACTATGAGGTTCT
CGCCACCAAAACCACTCAATACGCCGCTCGATTGCTCAAGAAGAATGAACAGGCCTTGATGGTGCTGAATTGTGCGCATCTCTTCTGGGTAAGTGCCTTC
AATCTAACTTTTTTTGGTAAAGGAACTGATCTAACACTTGTTCACTGGGCAGCACCCGTCTCAACAGGATGGAAAGCGTGTTCGAGAGTGCCTTCAGCGG
TCGCTACGCATTGCGGACGCTATCAAGGACACGACTTCGAACCAAGTTCCGCTTTTCCTGGAGATACTGGAGGCCGTATGTTGCCTTAGTTGTGACTTTC
TCACCTGTAGGCATTCGACTGACGCATTTCCCTGTGTACAGTATTTGTACTTTTTTGAAGCGCAGACACCGGAGGTGGCGCAAAACTATTTGGCGGGGCT
GCTGGCACTGGTGAAGGACCATTTGGATAACATGGAGCACGGTCACATGCGCAGAGAGGGCGAGTTCCGTTACCGCGCCATCGTGCGCTACATGGATACA
TTAGATATCTCCGACGTTGCACTGTCAACCTCGCCATCGTC