Description :
From Genome Similarity Track
Location :
Scaffold_1179:3012- 5465
Sequence
2453 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCCTCTCCCGCG
CGAACAGTGCGAGGTCATCCATTCCTTCTTCGCCGCGAAAGCGAAAGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTT
CGGAAGCCGAACGGAAAGTGGCGTCCAGTTCATGCTTATAACAAGCTGAACAACGCGACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGT
TAAACAACATGGCCGGGAGCGTACTGTACAGCGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGACATCCCGCTCACCGCGGT
GAGCACTCCAAGCGGCATGCTGTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGATAACGCAATTGTTCCGC
TCTTTGCGTACCTTCGTACAAACGGACTTTGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGCCGGCCATGGAGGTGTATCTAGGACACCTCC
GTCGAGTGTTGGACGTAAAGCGAGCAAACAAGCTTTACGCCAACATCGACAATTGCGTTCTCGCGTCACCAGAGATTAAAGCTCTCGGTTGCTTCGTAAG
CAACGTGGGCGTTCGGGCTGACTCAGACAAGGTCAAGGCCATCGCAGAATGGCCAGACGACCTGATCCCAAAAGGATCTTCGAAAGTGGTTGGGCTTGGC
CAACTACCTTCACAAGTACAGTGCAGGGTACGCGGGCTTCGCTGAGCCCTTGTCGGGCCTCCTTCACAAGGACGCCGACTGGCGCTGGGAGCAGGAGCAC
GAGGAATGCCTTTGAAAGAATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGACCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCC
GACTGTGCCATCGGTTGTGCACTGCTGCAGGCCGACGCGGCTGGACATGAACGCGTCATATCGTTCCAATCCAGGCAGCTCAAATCCGCCGAACAGAACT
ACCCTGTCCACGACAAGGAGCTCCTGGCACTAAAATATGCCCTTGTGAAGTTTCGTGCTCACCTTCTGGGCTCCCGGCCCTTCGTGATCTACACAGACCA
CGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAAGATGGGGACGTGGCTGTCCTACTTCGCGGAGTACAACTTCCGCGTCGAATACAAG
CCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCAGACTACGAATTGGCCCACATCACACGGGTGACAACGGATCTATATGATCGGATAC
GCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCTCTACGGCAGGAACGAGCGCGAAGTCCGATTGGCTCTCGTCGCGACAGCGCTC
ACGGCTCCACCGATATGAGTTGAAGGATGGCCTCCTCTATTACCGAGTGGAACCCAATGAACCTCTACGGATGGTCGTACCCAACGACAAGGATCTGAAG
TTCGACATTCTCGCGGAGGCGCACGACGCCCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTATCTCAGGCCTTCTGGTGGACCCACA
TGTACAAGTGGGTCGCCCATACATGAAGACATATGAAACATGTCAGCGGGTTTAACCCGCAAGGCACGCTTCGGCTCCACTACAGAGCCTGCTCGTACCG
GCTGACTGTTGGAAGTTGATGAGTCTTGACTTCATCTTTGGGCTTCCCACCGACGGACACGGAAACACCAGAATTTTTGTGTTCGTGTGTCGGCTGAGCA
AGATGGGACATCTTGTTCGGTTCCCGTCACTGTTTACGGGCGAACAAACCGCAAGGTTTTTCGTCGATGGCGTGCTCCGCTATCACGGTCTCCCGAGACG
AATGTCCCGGACCGAGACCGCGGTTCACGGCTGCGTTTTGGAAAACCTGTTTC